GenePrediction:GLEAN_4673 Details

Name: GLEAN_4673
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1102117..1101470 (- strand)
Length: 648
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1102117..1101744 (- strand)
Length: 374
Type: CDS
Source: GLEAN
Position: GCSC_167:1101695..1101470 (- strand)
Length: 226
>GLEAN_4673 class=GenePrediction position=GCSC_167:1102117..1101470 (- strand)
ATGGCGGCTCCCCAGTCCAAGCGGACGCGGCCGAACATTGTGGTGACGGGGACGCCTGGAACGGGCAAGACGACGCACTG
CGAAGCAGTGGTAGCTTCTGTGGGCGGCCAGGCGGCGGGGCTGCGTCACGTGTCGATCAACGAGCTGGTGCGAGACCGCG
ACTGCCACGACGGCTGGGATGCCGAGTACCAGAGCTGGCTAGTGGACGAGGACCGGCTGCTAGACGCGCTGGAGGCTGAC
GACGTGCCGCATGGCCGTGGTGCCGGCGTGCTGCTGGACTGGCATGCCTGCGACCTCTTTCCGACTGGTTGGATCGACCT
GGTGGTTGTGCTGACGGCCGACACGACGTCGCTCTACGACCGGCTGGCCGAGAGGTAGGTGGCTTTGTGGCGATGCCGAT
GGTCAATCGCTGACACGCGCAGAAAATACCCCGAAAAGAAGATGCAGGAGAACATTGACGCGGAGATCATGCAAGTCCTC
CTACAGGAGGCCCACGAGGCTTTCCCGCCCGAGATGGTGGTCACGCTGCAGTCCAACACGGTCGAGGACATGGAGTCCAA
CGTCGACCGCATCGTCGCCTGGGCCCAGCAGTGGTACAAGGACAACGACCTGCCGCTGCCGAGCAGCAAATCGGAGCAAA
AGGCATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62