GenePrediction:GLEAN_4674 Details

Name: GLEAN_4674
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1101244..1100147 (- strand)
Length: 1098
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1101244..1100921 (- strand)
Length: 324
Type: CDS
Source: GLEAN
Position: GCSC_167:1100777..1100704 (- strand)
Length: 74
Type: CDS
Source: GLEAN
Position: GCSC_167:1100648..1100504 (- strand)
Length: 145
Type: CDS
Source: GLEAN
Position: GCSC_167:1100445..1100409 (- strand)
Length: 37
Type: CDS
Source: GLEAN
Position: GCSC_167:1100342..1100309 (- strand)
Length: 34
Type: CDS
Source: GLEAN
Position: GCSC_167:1100243..1100147 (- strand)
Length: 97
>GLEAN_4674 class=GenePrediction position=GCSC_167:1101244..1100147 (- strand)
ATGCCGCTCGATAGCGGAGAAAGAGCCCCGCCAAGGCTAGAGCCAAACTCAACTCTATGGCAGAGCTGGCTTGCTGAATC
TGCCGACAACGACCACGCCCAACGCACGATGGCTTCTCCCACCACCGTCCTTCATTTCGTCACTGGCAATGCCAACAAGC
TGGCCGAGGTCCGCGCCATTCTAGAGCAGCCCGCGTCGTCGTCATCGTCGTCGTCTGTGCCGCTTCCCATCACGGTGACC
TCGCGCAGCATCGACCTGCTCGAGATTCAGGCAGCCTCCAAGGAGGAGGTCACGCTGGACAAGTGTCGCCGTGCCGTCGA
GATAGTATGTCTTTGGCATGCTTTCTGTTTTTCTTTTCTTCTGTTCTGTCTGTTCATTTTGCTCTTTTTATTCGCCTCCT
TTTGGCTATACACCTCTTCATGCTTCTTGTTTTCCTTCTTCCGTCTCCCTCACACTAACACTCCCAGATTCAAGGCCCCG
TCCTCGTCGAAGACACCTGCCTGTGCTTCAATGCCCTCAACGGACTGCCGGGACCGTATATGTAGGTCCTCCCATCCAGC
CGTCTCGCCAGCACGTCCGCTCACTCGCCCCCCCAGAAAATGGTTCATGACAAGTCTCGGCCACGACGGGCTTAACAAGC
TGCTGGCCGGCCACGAAGACAAGTCTGCCCAGGCCGTGTGCACTTTTGCGCTGAGCAAGGGCCCTGGCCACGAACCCATG
CTCTTCCAGGGCGTCACCGATGTCTGTTCTCACCCCCCCTCTACTTTCCACATTAGTCATCTCTGCTGATGTCAGACAGG
GCAAGATTGTCCCGGCTCGCGGCCCAGCCAACTTCGGTGCGTCCATAAGCCGACCCTCCTCTTCTTCTCCGACGTCTTGG
TCTAGCTAACTGACACCCTCAGGTTGGGATCCAATCTTTGAGTACGAGGGAAAGACGTGAGACCCTCCTGTCCTCTGATT
CTTGTCGAGTTGTTTTCTCTCTTGCTGACCCCCATCAACAGCTACGCCGAGATGGACAAGGAACAAAAGAATACCATCTC
CCATCGTTACAAGGCTCTGCAGAAGCTGCGCGAGTATCTCGCTGCTGAGATGGCCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62