GenePrediction:GLEAN_4675 Details

Name: GLEAN_4675
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1090337..1089022 (- strand)
Length: 1316
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1090337..1090134 (- strand)
Length: 204
Type: CDS
Source: GLEAN
Position: GCSC_167:1090014..1089868 (- strand)
Length: 147
Type: CDS
Source: GLEAN
Position: GCSC_167:1089818..1089579 (- strand)
Length: 240
Type: CDS
Source: GLEAN
Position: GCSC_167:1089507..1089022 (- strand)
Length: 486
>GLEAN_4675 class=GenePrediction position=GCSC_167:1090337..1089022 (- strand)
ATGGGTCGAAGCTTTTTTCCCCTGTCCGTGGTCGTGGCCGTGTTGTCAGTGTCTGTAGCACTCGCCAAGAGGACCTGCAG
TCTCCACGCACAGCTTGCCGCCGTGCTGTCTCCCGAGGCTGAGCTGTTTGTTCCCTCAGACTCGGACTATGGCAACGCCA
GCATTCGTTGGTCCAACTTTGACGAGCCCACCTTCCAGGCATACGTCGAAGTGGACACGGAGCATGACATTTAGGAAACT
GTAAGCAAGGGTCCGGTTCTATTCAGTGAAAGGCAGCACCCACTCACTAGACGCTCCCAGGTTCGATTCGCTAATGAGCA
CAGCCTCGCCTTCCTTGCGGCCACGGCTGGACCTCCAAGCTCAGAGGTGTGCAGGGCGGCATCGGAATATCGACTGTCAA
GCTGAACGCGACAGAGATCAGCGAGGACGGCAAAACGGCCCGGCTGGGCGGCGGCATCAAGAGCGGTGCAGTCGAGAAGT
TCCTGACTGCCAATGGCAAGCGCTCAAGTAAGTTTACAGGCACTCAAGGGGGCTGGCCAGAACTTTGGCATCGTCACCGA
GCTTACCTACAAGATCTACGATGCCCCTGCCGAGGACAGTTGGATCGTCAAGACGTTCATATACTCGCCCGACAAGATTG
CCGACTTTTACACGCAGATGAACGACTTCACTGGCAACGGCACCGACTGGGAAGCCCAGCCGGCCGGCCTTCTCCTGGCC
TCCCTCTATATCATGGAGACGAGCGTCAACCCGGACGCGGTATGTTGTTTTCCGGCTCCTCGACCATTTGCGTGTTTGCT
GCCATGCTGACTCTACCATCGGGCCCGCAGCCGGTGCTTGTCTTGCTCATGGTCTACGACGGCACCGAGGAGGGGTTGGA
GTCGATGGCCGCCCGGTTCCATGCCGTGGGCCCTGTGTACAATTTTACGGAGACGGTGTCCTATAGCGAAACATCGCCTC
CTCGAGTACGGCTGTCGCCCATCGGGACCAGGGCATTATTGTGTAAGCTTCAGAACGTGCTTTCTGACATTGTGAGAGAG
GCCGTCCCGAACACTGTTTCTAGGCTCTTCTCGGGAATTTACTGGGACGCCGAGCACGACGCGGCAACGAAGCAGGCCGG
AGAGAAGGTCCGGAGCCTGCTCTACAACGGCACCGGCAGCTCAGACCTCAACGTCTATGTCGGCTATGCCAATGGAGACG
AGACCGCCCAGCAGCTCTTCGGAAGCGACCGCTCCAAGCTCGAAAAGCTGGTGCAGCTGAAAAAGCGCTACGACCCGCTG
GAGCGCTTCAGGTTCTATGCTCCGCTTACGCAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62