GenePrediction:GLEAN_4677 Details

Name: GLEAN_4677
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1084015..1083122 (- strand)
Length: 894
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1084015..1083876 (- strand)
Length: 140
Type: CDS
Source: GLEAN
Position: GCSC_167:1083786..1083256 (- strand)
Length: 531
Type: CDS
Source: GLEAN
Position: GCSC_167:1083173..1083122 (- strand)
Length: 52
>GLEAN_4677 class=GenePrediction position=GCSC_167:1084015..1083122 (- strand)
ATGGCGTCCAAGCCTGCGACCACCCAGTGCGTGGGGCCCACGTACAAGACAGAGAAGCCGACCGCAACGGTCTCGACGCC
CGTTGAATTCGACATGGTCACGGTGCTGCCACAGACACCTCAGTTGATCGCCCTCTTGTCGTAGGTTTTCTGCCTTGCTT
TTTTGCTCTTCCTTCTCCTTCTTCTCCTCGCACGTGGGCGTTCTGCCGGTCAACTAACAGCTCCGACAGAATTATCCGTG
ACAAGAGCACCGATCGCGGCGACTTCATCTTCTACTCCAACCGCATCATCCGACTGCTCGTCGAGGAGGGGCTCAACCAC
CTGCCGACGGTCGAGCGGACGGTGACCACGCCGGTCGGACGGCCATACGCCGGCCTCCAGTTCCAGGGCAAGATCTGCGG
CGTGTCCATCATGCGGGCAGGCGAGGCCATGGAGCAGGGCCTGCGCGACTGCTGCCGGTCGGTACGCATCGGCAAGATCC
TGATCCAGCGCGACGAGGAGACGTCCCAGCCGAAGCTGTTCTACGACAAGTTGCCCGAGGACATTGCCGACCGTTGGGTG
CTGCTGCTGGACCCCATGTTTGCCACCGGCGGTTCGGCCATCATGGCTGTGGAGGTGCTTATGTCGCGCGGCGTGCCCGA
AGATCGCATCCTATTCCTCAACCTGATTGCGAGCCCCGAGGGCATCGCCAAGTTTGCACTCCGGTTCCCGCGTGTGCGCG
TGGTGACTGCCTTTGTCGACGAGGGCCTCGACGGGAAAAAGTGCGTATTCCAGCCCTCAAGCATCGTGACCGCCGCTCTG
CCCTGCTCTCCTCTCGGCCGTACTGACACGCTTGTTTCACAGCTACATCGTCCCGGGTCTGGGTGACTTTGGCGATCGAT
ACTACACGGTCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62