GenePrediction:GLEAN_4678 Details

Name: GLEAN_4678
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1081134..1078109 (- strand)
Length: 3026
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1081134..1080797 (- strand)
Length: 338
Type: CDS
Source: GLEAN
Position: GCSC_167:1080730..1080612 (- strand)
Length: 119
Type: CDS
Source: GLEAN
Position: GCSC_167:1080518..1080510 (- strand)
Length: 9
Type: CDS
Source: GLEAN
Position: GCSC_167:1080441..1080372 (- strand)
Length: 70
Type: CDS
Source: GLEAN
Position: GCSC_167:1080309..1080170 (- strand)
Length: 140
Type: CDS
Source: GLEAN
Position: GCSC_167:1080090..1080047 (- strand)
Length: 44
Type: CDS
Source: GLEAN
Position: GCSC_167:1079977..1079940 (- strand)
Length: 38
Type: CDS
Source: GLEAN
Position: GCSC_167:1079871..1079802 (- strand)
Length: 70
Type: CDS
Source: GLEAN
Position: GCSC_167:1079727..1079688 (- strand)
Length: 40
Type: CDS
Source: GLEAN
Position: GCSC_167:1079618..1079563 (- strand)
Length: 56
Type: CDS
Source: GLEAN
Position: GCSC_167:1079493..1079451 (- strand)
Length: 43
Type: CDS
Source: GLEAN
Position: GCSC_167:1079387..1079317 (- strand)
Length: 71
Type: CDS
Source: GLEAN
Position: GCSC_167:1079244..1079085 (- strand)
Length: 160
Type: CDS
Source: GLEAN
Position: GCSC_167:1078908..1078746 (- strand)
Length: 163
Type: CDS
Source: GLEAN
Position: GCSC_167:1078645..1078616 (- strand)
Length: 30
Type: CDS
Source: GLEAN
Position: GCSC_167:1078392..1078307 (- strand)
Length: 86
Type: CDS
Source: GLEAN
Position: GCSC_167:1078182..1078109 (- strand)
Length: 74
>GLEAN_4678 class=GenePrediction position=GCSC_167:1081134..1078109 (- strand)
ATGGCGACCGTTTCTAACCCCGCCACCGCCTCCGGGCCCGTCGACATGACCACGATCGTGGACATCCTGAAGCGCATTGA
GCTGTCTCAAGCCGAACTTCTGACCGCTCTGCAGTCATCGACATCGGCGTCGACAGGATCTGCTCTCCTCCCACCACATG
TAGCTGCTGCTGCTGTCGCTGCACTTATCCCCTCCTCTTTAGCAGTTCCGCCAGCTGATACAGCAGGCGAACAGTCTGCT
GCCGTGCCAACTGACGAGACAGATGGCTCCTCGACGACCACCCTCGCAGCAGCGTCCAGCAGCCCAAAGTCGCCCTTTAC
GTCACGCATCGTGCTCACGTATGTGCATTCTCCCCTGGGAAGCCGAGGACTATAGCACCTAACTTATACCTCCCAAAAAC
AAAGCACCTATCCTAAGCAGATCGGCATCAATCCGTTCACGATGAACTGGGGCGCGTTGGACCCCCAAGAACGCGGCCCA
ATCGTGGTATCTAGGTCGTCATCGACCATCCGTCGACGCAATGGTGTGACTATGCCAGGCGTTTCCAATCCTTCTGGTGG
TTTCGTGCGGGAGAAACTGGCTCTGTGCTAACATGACTGATGTTGTCTACTGTCAGCTATTGGAGGTTTGTCTTGATTGC
TTATCCAGTTCCAGTGTCCTCACTTCAGAAAACTAACATGTTCATCTTGGCAGCACACGGCGGCTCATACTCGATATACT
ATGCACTTGCACTAGCCAGCCAAGAACTCAAGGCCGATCATAGGTGGGCATTCGAAGCCCCTTCAACCTATATGGGTTTC
AAAGGTGTTCTGACCACCGCTCTAGACCCGACTTTACGAACACGGAGCCAGCCGCCGCCCTCGGGCCGTTTCCTCAATGG
GGCGACAAGAAGAAAATTGTCGCCATGGATCCATGGGGTCATCTGGCCCCGTTTCTTTGGAAGAAAGAGATCGACAGTCA
AAACGGTATGCTCAGTGTCACGCAGATGAAGATCTAAGTCGGCTTTCTGCCTTTATCATCTAACCGATGATGGCGCTGCA
ACAGTGGACATACGGCCGACTATCGCTATCACCAAAGCGCACATGATTGTTAGTATCCCTGCTGCTGTTTCTTTGCAGCT
GCTACCGATTCGTATCAACTAACCAGGGCTATTGCAGCTCCCCGAACTCGAGGAAAGCGTCCGCAAAGGCAGACTGTGAG
TGCACACATTCTTTTGATGGCTGCACACTATCACAGAACTTACACATCTTTTCCCTATATTAGCGTCCCCGATGGCAAGG
TGTGCTTGAACGAGAAGGGAGAATTGGCCGTGACGAAGTTTGCGGTAGAGCCGGTATGTTCAATTCATATTCGGGTGTTG
ATTGTTGTCCATCTTTGCCACTTTTTTTGACAACTCCTTTTCCTCAGGTTTGGTACCTTCCAGGCGTGGCTGAGAGATTT
GGTATCGGTATGCATGGTGGCGTTGATGAAGATCCCGGGGTCTGCAAGGGTTTTTTTTCTGACGCTCTGGACATAGACGA
AGGTCTCCTCCGTCGATCGCTTTTTGAACATACCGGGGGCAGCTATCCTGAGGTTCGTGATAGGCGAAGGCACCGGTGAC
TATGTTTCAGCCGCATCGAAGCTGATCTGTCTTTTATGCAGCTCATCACGCGCGGCGACATCAAGGTATTCTTGCCTCCA
ATCGGTATGTGCTCCGGGAAACATGCTCAGAGTGAAGAACAGCAACGCTCACAATTATTCTCTCCAGGCGGTCTGACAGT
CTACTGCTTCGGAGATCCGGAAAAGATGTCCGATCCGGCCTCCAAATTGGCACTGCGGGTACATGACGAGGTGATTCTTG
ACCATATTACTTTTTACGCTGTATCGCACCGAGTATTAACGCCATGCCAGTGCAATGGAAGTGATGTTTTTGGCTCAGAC
ATCTGCACGTGCAGACCTTATCTCATCTTCGGCATTGAGGAGGCCGTCAAGGAGGCCCAGCGCGGCGGCAGCGGTGTGGT
GATTTACTTCCGGAAGGAAGGCCGCGCTCTCGGAGAGGTCACCAAAGTGAGTGAGAGACCAACGTGTTTTATCTCCCCTG
GGGAGGGGTGTATGTAAAATGAATAGGCCGCAACAAGCTGACATGTTACAGTATCGTACGACAAGACTCATTCTCATGCC
AGTATTCCAGGTATCCGCCTGGATATCGAACCGTTATCTGGCTACTGACAATATTTCTTTCCATAGTGGTGTACAACGCC
AGGAAGCGAGGCGAGGACCGCGCATCGGACTACTTCAAGCGGACAGAGAATGTTGCCGGCGTCAAGGACATGCGGTTTCA
GGCCCTGATGCCTGACATCCTCCACTGGCTGGGTATTACCAAGATTGACCGCATGCTCAGCATGAGCAAGTACGATTGGT
CTATTTTCTTATTTTCTTGCTTTTATTTTTTCCACTCGCCTGTCACTTCCGTAGGCTTTCTACTGGCGGTCTGGCTAACA
CAATTACAGCATGAAACACGATGCCATCGTTAGTCAAGGGTATGTATCCTGTTACTCGAGAAGCAGGTTTGTCACTGTCG
GCCGTTGCTCTCACACCAACTTCCTGGAATGTTGGTGTCTCTGCAGTCCGCCATGTTAGAGATGACCGGATGGCTTTGAC
AAGTATACGGCTGATTTTGAGCCTTCTTGGCTTTTTTTTTTTTGCCCTCTGGCCCCGAACGTCTTTTTCTCCAGTAACGT
GCAGGCTGACAGGTCACCCTAGTATCCCTATTATTGAGCGTGTCGAGCTCCCCGAAGAATGGATTCCAGCCGACTCTAGG
GTCGAGATTGACGCAAAGATCAATGCCGGTAAGACAGCTTGATGTCCCACTCCTTCTGTTCCCACTCTCACCCCTCTTTC
TGTTGCCTCTGCGAATGAGAGAGAGCAATTCATAGAGGGCGGCATGACACTAATGCCGAGTGCTGTCCGCAGGATATTTC
ACAACTGGACACAGAATGACAGCCGATGAGCTGCAGGCCGTGCAGGGTAGAACCTGGGAAGAGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62