GenePrediction:GLEAN_4679 Details

Name: GLEAN_4679
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1074308..1073673 (- strand)
Length: 636
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1074308..1073840 (- strand)
Length: 469
Type: CDS
Source: GLEAN
Position: GCSC_167:1073761..1073673 (- strand)
Length: 89
>GLEAN_4679 class=GenePrediction position=GCSC_167:1074308..1073673 (- strand)
ATGCAGCGAGACTCCTCTCGCTCGGCCAGCCACAGGAGGCCCCGCCTCATGCGTGCCTGCGCCACCGAGCCATCTTCCAT
CATCACCGCCTCGATCGCGAACCACAGCCCAGCGTCCCCTAGTGACAGCAGCATGAGCGGCCGTCCGAATGCGTATCGAC
GTGCCACAGACCTGCTCAACCGTGTCGCATACATGTCGGCATGCGCCTCCTCACCCAACGCTACCTACACCAGCAGTCCC
CGACGGCCTACATCGCTTCGCAGCGTCCCAGGAACGTCTTCTGAAGCTATCGGCGTCTCCCACGGCCCCGGAAGCCGAGG
TGCGGCCGTTGCTGTAAACACTCGCAGCAGTGGTGAGGACATTCGCAGCAGCCGCCGGCGATCATCCGAAGACGTCTTCG
GCTCATCACCAGCATCAACCAACACCGGCACATCACTAGACGACGACCTTCACTCACCATCTCATCCATGTCAGTCCCTC
CCCCAGTCTAGTCTTTAATACAGATCATTCAATCGAAGGACGAACGCCATGCTAACCCCATCTCCAGACTCGGTAAACTA
CTTCAGCTTTCCAAGCTTTGACACCTGGGACCCGGATAGCCAGGATAAGGAGGACGAGGACGGCAAAATGCCTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62