GenePrediction:GLEAN_4680 Details

Name: GLEAN_4680
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1072276..1069527 (- strand)
Length: 2750
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1072276..1072263 (- strand)
Length: 14
Type: CDS
Source: GLEAN
Position: GCSC_167:1072115..1072031 (- strand)
Length: 85
Type: CDS
Source: GLEAN
Position: GCSC_167:1071955..1071930 (- strand)
Length: 26
Type: CDS
Source: GLEAN
Position: GCSC_167:1071787..1071286 (- strand)
Length: 502
Type: CDS
Source: GLEAN
Position: GCSC_167:1071219..1071082 (- strand)
Length: 138
Type: CDS
Source: GLEAN
Position: GCSC_167:1070481..1070442 (- strand)
Length: 40
Type: CDS
Source: GLEAN
Position: GCSC_167:1070338..1070268 (- strand)
Length: 71
Type: CDS
Source: GLEAN
Position: GCSC_167:1070003..1069527 (- strand)
Length: 477
>GLEAN_4680 class=GenePrediction position=GCSC_167:1072276..1069527 (- strand)
ATGGCGGTTGGAAAGTACGTGCAAACCCCCTCGGCCGTGGATGGACGAACTCTCGCTGTTTTCGTTTCTACCCTCGCCTC
GAGATGACCAGAGGATAGCGCAGCGACACAGCGACAGGACGAGTCCGACGACCAGCAGACATGCTAACGAAGCATCTACA
GGAACAAGAGATTGTCGAAGGGCAAGAAGGGCCTGAAGAAGAAGACCGTCGACCCCTTCACCCGCAAGGACTGGTTCAGC
ATCAAGGTCAGTCTAATACGCTCCATGGGGAGAGCAGAGAAAGACGACTGGAGAAGAGGAATATTAACAACGTCATTACA
GGCCCCTACCACCTTCGCCCACCGGGAGTAAGCATAGAGAACCCCTACCTGCGAGATGAGGTTGCGAGAAGATGGAAAGC
TGGCCGACTTGGAGTTTCAATGCACGCTTGAGGACGATCGAAACTCTTCAGCAGTTCTCAGTTCTAACCCTGTCTTTCTT
TTCCTGCAGTGTCGGCAAGACGCTCGTCAACCGGACCACCGGTCTGAAGAACGCCAACGATGCCCTCAAGGGCCGTGTCG
TTGAGGTCTCCCTCGCCGACCTGCAGAACGATGAGGAGCACTCTTTCCGCAAGATTAAGCTCCGCGTCGACGAGGTTCAG
GGCAAGAACTGCCTAACCAACTTCCACGGCCTGGACTTCACGTCCGACAAGCTCCGCTCGCTCGTGCGCAAGTGGCAGTC
GCTGATCGAGGCCAACGTCACCGTCAAGACCACCGACGACTACCTGCTGCGCCTGTTCGCCATCGCTTTTACCAAGCGCC
GCCCCAACCAGATCAAGAAGACGACCTATGCCGCTTCTTCGCAGATCCGCGCCATTCGGAGAAAGATGACCGAGATCATC
CAGCGCGAGGCCAGCAGCTGCACTCTGCAGCAGCTGACGGCTAAGCTGATCCCTGAGGTCATCGGCCGCGAGATTGAGAA
GTCCACCCAGGGCATCTACCCCCTGCAGAACGTGAGCTCACTCTCCCTCTGACCCCCTTCCACTTCCTCCCTTGACCCGT
CCTCTAACCCGTCACAGGTCCACATCCGCAAGGTTAAGCTGCTGAAGCAGCCCAAGTTCGACCTGGGCGCCCTTCTGGCC
CTGCACGGCGAGTCCGGCGGTGGCGAGTCTGGCGAGAAGGTTGACCGGGAGTTCAAGGAGGTCGTCCTCGAAGAGGTATG
AACGGGACTGCTTATGTATGGTGGAAGCGGTCCGGAAGGCTTGTATGTAGGGCGTCTGCTATGTGAAACCAAAAAAAAGT
TTTGAACATGAACATGAACAGGAACGAGCAAGATATCCGTGTCCTGAGTCAACGCCAAGGGGAGGGAGAGAAGAAGAAAA
AGAAAGGAGGAAAGGGAAACGGAGCATGGGCAACGGTTTACTCTTTTTGTGTTCCTTTTTTTTAATCGAGAGAAAAAACA
ACTCTTGCCTTACAATATCTCCAAAAGTCCTCTGCACGGTGGTAGCATATCTATCACTGCCCTTCTTCCAAGCATTTTAA
ATTGCGCATCGGAGGTTCTTGATCATTATAGAGAAACCTGTGCTAGTTACGACATTCGGCCGAAATGGGAAGGCGCGCTC
ATCGCAGCCTGCTGTGGCGAGGCCCGCGCAATATGGCCAGCCAATGGCAGATAATCGCTCGACAGATGGTCCTCACAATA
AGCCCATGTTTTAAATCCTTCACATGTCAATTCTCCAAGAAACAGAGCTGTGTAGCTGATCATACGGCCTTTTTTTTCGC
CCATTATGTCCAAAGCTACTGAACCCTTCCTTAAGATTCTCATCATCGGGCCCTCCAATGTGGGCAAGTCAGCATGTATG
GCCTCCTTCTTAAGGATTGAGATAGACCTGTTTCCTCGGTCTCTTTGTCTTCACCGGCTCTCCTCTTTTTTCGCGCTGCT
AACCTGGCCAAATGGAAGTGCTCAAGCGATACTGCGATGACGATTTCGATCCGAACGATTCCGCAGCTACCATCGGAATC
GACTTCCGCGTGCGTCCAAGGCGCTGTTGATTGCTTTCTGCGTCTTCTTTCCTCTTGCTCCCTATCCCTTATAGCTGACT
CTTCATGGGCCTGGTTCTTAGATCAAGCGTTTGTCTGTCCATGGAAAGACATACCGCGTAAATCTACTCGATACGGTGAG
CAGCTGCGCGACTCTCCTGTGTCCCCACCGGGCCTGACCGTCTTGTCAATCTTGTCGATTTGGCGCGACCTTTGCCTCTC
TTCCTCGTTCTTACGTCCTCTGTCATATTCTAGGCTGGCCAGGAACGCTTCCGGACTCTGTCTACTAGCTACTACCGCGG
CGCCCATGGCATCATCTTCGTCTACGACCTCACCAGCCGCCCCACGTTCGCCCAGATGGACACCTGGTTCGCTGAGGCCG
AGGCCAACACAATCGCAGCTGCGGGACCAAATATGCCGCCATGTCAGTATTGCCTCGTCGCAGCCAAGGCCGATCGTGCC
GACACCAGCCGTGTCGTATCGACCGAGGAAGGCCTGGCCTTGGCACGCAAGTACAGTCCCCCCACGGCGGATGAAGCCGA
GCCGCTCTTCTTCGAGACAAGTGCTCGCACCGGCGACAACGTGCGTGGTCCCTTTCTGGCGCTAGTGGACCGCATCGTGA
CATCCGGAATGGCGGCTGGCTCGACGTCGACAGCAGCCCCAGCTGCGATCGTGTCTTTAGGAGACGCAGGCTCGACAGGC
CCTGAGGACAACTCTGGTTGCGCATGTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62