GenePrediction:GLEAN_4681 Details

Name: GLEAN_4681
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1067704..1065860 (- strand)
Length: 1845
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1067704..1065860 (- strand)
Length: 1845
>GLEAN_4681 class=GenePrediction position=GCSC_167:1067704..1065860 (- strand)
ATGAGGCCTGGGCGCTTGAACGGCCCCATGTTCAAACGTCCCATCGTTGTCGCCCTCTTCCTCCTCCTCACCACCCAGGC
TGCCTTTGCAGCAGCATCATCCGCAGATTTACAAGCGGGCCGCAGGAACTCGGCGCCGTCGCCGCGCCATGACAGCTCCC
GATCGTCGTCAGCATTTCCGCTGATCACCTGGCTGCGCGACTCGGCCATCGAGCTCGTCTTTGGCAAGCACCCATCCTCG
TCTGGCGGTGGCAGCAGCGGCAGTGTAAGCAGCGGCGGATCGCACTACTCGTCGTACTACCAGCCTGCGCGTTACTCCAA
ACAGACGGTCATCCGATTTATTGTGTCGACGGCGGCCGAGGAATTTGCGCTCGCAGAGGCGACTAGTCGGCTCTTCCTGG
ATATCTGGGTATTCAACAACCACACGGGCACAGTGGACGTCCGTCTCAACAAGGAAGATGTGCCGTCGCTGCTGACGCTC
CTGCCAGAGTCGCTGCACTACGCCTTCTCGCCGCTGATCCCCGATCTGGCCGTGGCCGTGCAAGACACTTACCCCAAGGT
AGCAGGGGCCAAGAGTGCGGCGGTGGCGCAGCTGTCTGCGTTCACGTCGGGCGGGAGCACGTCTGCCGCCGGCGTGGGTG
CGGTTCTTGGTACGGGACTGGACAATGTTTTCTTTCAGGACTACCAGCCGCTGCCCGTAATCGAGCAGTGGATGAGGCTG
ATGGACGTCATGTTTCCCTTTGTGGAGATGATCAGCGTTGGCCAATCGGCCGAGGGTCGGGAGGTTTTCGGTCTGCGAGT
GGGCGCATCGAAGAGAGACGACGACGGTGCCGACGACGTGAATGATGGCGACGACCCGGAACAGCCGGAGCCGAAACCGG
GGCCGTCGACGAAGAGGAAGACGATCCTGATGACGGGTGGGCTGCACGCGCGGGAATGGATCACGACGAGCACAGTCAAC
TACGTGGCCTGGTCACTGATTGCAGGCTACGGCAAGGCACGTCTGATCACGAAGCTGCTGGACCACTTTGACGTGGTGTT
TGTGCCGGTGGTCAATCCGGACGGCTACGAGTACACGTGGCACACGGACCGACTGTGGCGCAAGTCGCGGCAGGGCACCA
ACTTCCGGTACTGCCGCGGGCTGGACCTGGACCACGCCTTTGGCTTCGCGTGGGACAACAACGTGCACGTGGAGCCGTGC
TCTGAGTCGTACGGCGGCGAGGCAGCCTTCCAGGCGGTGGAGGCGCGTACGCTGGCGACGTGGGCGCGTGGCGAAGTGCT
GCTGCGGGACGTCGAGTTTGTCGGCTTCCTGGACCTGCACTCATACTCGCAGCAGATCCTTTTTCCGTTCTCGTACTCAT
GCGAGGCTGACCCGCCGAACCTGGAGAACCTGGAGGAGCTGGCGGCTGGGCTGGCCAAGGCCATTCGGCTGTCGACGGGC
GAGCTGTACAGCATCTCGTCGGCGTGCGAGGGCGTGCTGAGCATGGGCGACTGGTCGTCGGGTGAGCCGGCGCTGGGTCG
TATCGAGTCGGGCGGCGGCTCGGCCATCGACTGGTTCTACCACGAGATGCACGCGCGCTATAGCTACCAGATCAAGCTGC
GCGACACGGGCAGCTACGGCTTCCTGCTACCGTCGTCGGATATCGTGCCAACGGGCGAGGAGATCTTCAGCGCGTTCAAG
TACTTTGGCGACTTTCTGCTAGGCAACAACGGCATCGAGCGGTCGTTTGGGCCTGACGACAAGGATAGCGGCAGCAAGAC
GAGCAAGACGAGCAAGATCACAGAGTTGGCAAAGGGCAACAACGGCGATCACTGGACTGAATTGCGGAGGCGAACGCAGA
AGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62