GenePrediction:GLEAN_4682 Details

Name: GLEAN_4682
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1064413..1062695 (- strand)
Length: 1719
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1064413..1064151 (- strand)
Length: 263
Type: CDS
Source: GLEAN
Position: GCSC_167:1064081..1062695 (- strand)
Length: 1387
>GLEAN_4682 class=GenePrediction position=GCSC_167:1064413..1062695 (- strand)
ATGGATGCACAGACCCTGACCGACTCACAGTTGAGAGGCTTCAGTGTCACAGAGCGGGTCTGCTCTGTGTTCTCGCTTCT
CGGCAGCATCCTCGTCATCAGCACGTTCTGCGCGTCAAAGTCCTTTCACAAGCCTATCAACAGGCTCGTCTTCTACGCCT
CGTTTGGAAATATGATGACCAACGTGGCCACGCTGATGGCTCGCTCGTACATTGACCGTCCACAGTCGCCAGGCTGTCAG
TTCCAAGCCTTTCTCATCCAGATGTAAGCAGGTCTTGGGGGGAAAGAAGAAAAGAAAGAACAGAAAACTGATACGTCACC
CTCCCATCCCAGGTTTATGCCTGCAGACGCCTTCTGGACATTGGCCATGGCCATCAACGTCTATCTGACCATTTACTGCA
AGTTTGACGCGCAAAAGCTGCGCCGCATGGAGACACCGTACCTTGCCTGCTGCTACGGCGTGCCCTTTGTGGTGGCGATC
GCGTACGTCTTTGTCGACGACCGGCAACATGGCCGAATGTACGGCAACGCAACGCTGTGGTGCTGGGTCAGCTCGAGCTG
GGATGCCTGGCGCATTGCCACCTTTTACGGCCCCGTCTGGGTCGTCATCCTGGTGACCTTTTTCATCTACATTCGCGCCG
GTCGCGAGATCTACCACAAGCACAAGCAGCTGCGTGACTTTCAGTACAGCAGCAGCCACCAGGACGTCGAGCCGCTTCCG
CCTTCCGACGATATGTACGGCACCACCAAGATGACCGAAGTTGTCGTTACCACCGAAATTTTCGGGCACCCGCAGGGCCA
ACAGGACATTAACCTAGCGCCTTTAGGCCGCCGCCCTTCGGTCATAAAATCCAGCGATGTCATGGCAGCAGGTGCAAAGG
GAGCAGATCTAGACGGTCAAGCAGCAGCCTGTGTCGTCACCATCTCATCCGACAGGTGGCCAGACGTCGTAGTCGTGGGC
AGTGAGGCCGATGCTGACGATGCTGACGATGCTGCTGCTGTTGGCGGCATTGTCAAGGCCACGACCACAGCCACGATCAC
GGCCACGGCCACGGCAACCATCCGCAATCCAGCCAGCCAGCGCATGCGTCGCCGTGCCGCCTACGAGGCCAACAGTGCGG
CCTGGGCGTACGCCAAGTGCGCACTGCTATTCTTCACGGCACTGTTGGTCACGTGGATTCCCTCGAGTGCAAACCGCGTC
TTCTCTGTCGTCCATGTAGACCAGGTCTCGGTGCCGCTCGAGTACATGAGCGCCTTTGTGCTGCCGCTGCAGGGCTTTTG
GAACGCCATCATCTACGTCGTCACGTCGTGGAAGGCTGTCTGCACGCTGTGGGATGACGTCACCGCTGAGGCCCAGTGCA
ACCGCAGGCAACGCTGGCTGCGAGGAGCACAAGGATCGAATCAGCAGCAACAACAGCTCCATCCAAGTGAACAGAAACAG
CTGCACACCGATATCCACCTGGTCCGTGTCGACGCCAAGGCAACCCAGCTCAAAATGCCAGGCGCCCGGAGCCGCAGAGA
TAGCGACGAGATGCTCGTCCGGACGGTCGGTAGCCATTATGCAGTCGATGGTGATGGTGATGGTGATGGTGATGGTGATG
GTGATGGTGATGGCGATGGCTACGGCAGTTCCAGCAGCCGCGGCCAGTCGGAACAGAGCTACGAGAACGAGAGCGTGAAA
GAATTCGCCGTCGTCCGCACGAAATCGCTAGGCAGCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62