GenePrediction:GLEAN_4683 Details

Name: GLEAN_4683
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1057598..1055242 (- strand)
Length: 2357
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1057598..1057464 (- strand)
Length: 135
Type: CDS
Source: GLEAN
Position: GCSC_167:1056225..1055815 (- strand)
Length: 411
Type: CDS
Source: GLEAN
Position: GCSC_167:1055739..1055242 (- strand)
Length: 498
>GLEAN_4683 class=GenePrediction position=GCSC_167:1057598..1055242 (- strand)
ATGATCTTCAGCGGACTCCTCGAGGGTGGCATAAGATACCGGATCAGCAACATCAGAGACCGATTGGCCAATATCAATGA
GGCAATTAACAAGTCCAAGTTTGGCCGTATCTTCAGGCTCCGAGGCTGTGCTCACGTACGTCTTCTTTGCCTTTGATTTT
GGCCTCGCAAACGTCCTTCCAGATCAGTCATTGGGACCAGGCTGATTGTTTGCGTTCCTCGATCTTTAGTCTGAAGAGAT
TCGCCATGCAAACTTTGCCACAGAGATTCGCGCAGGCCTCACGACATTTGCAACCATGGCATATATAATTGCCGTCAACG
TTAGTAATGCGTCCTTTATCGGCTCTACTCATGGCCCTTATAGAGTCAACTGATGCTATGGCTAGGCTTCTATTCTTGCT
TCTACCGATGGAACTTGTGTTTGCAGTGATCGTATGTCTGATGGAGACTGTAACAACGCCAACTTCAGGACTTGTAAGGA
CGGTAAGATAGCCAACTTTCGATATGAAATTAACGATAAATATCCTGCTAATAGGACTACTTGTGAAGAGCTTCATCGGG
ACTTTATCACCGCCACCGCGATTGTCTCTGGCCTCGCTTCCATGGTTTTCGGCTTTGTAACAAATCTTCCGGTCTCCCTG
GCGTATGTTCAGTGCTTTCCTTCACCGTCCTGCACGGCGCATAATCTTCTGCGGCTGACACATACAGGCCTGGAATGGGA
CTCAATGCATACTTCACATACCAGGTCGTCGGTGTGTCTGGCCAGGGCCCCGTCCCCTACCGACTAGCTCTCACAGCCGT
TTTTGTTGAAGGCTTCATATTTCTCTTTCTTGCGCTAACCGGGATGCGACAATGGCTCATCAAAATCATCCCGGGAACAC
TCAAGACAGCCAGTGGGGTTGGAATTGGGATGTTTCTCGCTCTTGCGGGCATGTCATATGCATCGGGCATAGGCATTGTG
TCAGGAGGGGGGTTGGCAACGCCTCTTGCCATAAGCGGCTGCCCCGAGGAAGACATTGACATAGACGGTACTTGTATGGC
CAACGTGATGCGAAATCCGAAGGTAGATCCGACCTTTGGCGTATATTTGGTTTGGGCACAGAGCACAAGCTGACAATGTG
TCGAAATGCACAGATGTGGCTCGGGATTGCTGGAGGCATTCTAACGGCTTTGCTCATGGCATTTCGAGTGAAAGCGGCAA
TAATTATCGGAATTGCATTCGCGACTGTCGTATCGTGGCCGTAAGCTTGCATATTTTCGCGATATGCTGCCTGGAAGCAG
AAAGCGAGGCTGACTAGCTGCAGGCGCAACACGACCGTTACGTATTTCCCCCACACATATGAAGGCGATACACGATGGAA
TTTCTTCCGACAGGTGGTCGCATTTGCACCGATCAAGCACATCCTTGGTGTTCAGCAATGGGATCTGAGCGGCGCGAGCG
GCGCGCACTTTGCTGTTGCACTGTTCACGTTTTTATACGTTGACATTGTCGACTGCACGGCGACTTTATATTCGATGGCA
CGATTTAGCGGCAAAACAGGCCCAGACGGCGACTTTCCACGATCAACTGCGGCCTACTGCACGGATGCCATTTTCATTTC
CATTGGATCTGTGTTTGGGTGCTCGCCTTCCACGGCTTTTATCGAGAGCGGTGCTGGCATCGCGGAAGGCGGCCGCACAG
GCCTGACGGCCATGGTGACTGGGCTCTGCTTTATCATTTCTATATTTTTCTCTCCGATTTTTGCATCAGTTCCACCATGG
GCGACAGGCACGACACTGATTGTGGTAAGTGGTTTTCGAGACGTCCAGTGCTAGTATATGCTCATTCTGGAACAGGTTGG
CTGTCTCATGATCCGACAGGTAACGTTTATCAACTGGAACTATATTGGCGATGCAATACCGTCGTTCGTCACCATTGTCT
TTATGCCGTTTAGCTACAGTGTTGCGTACGGCCTAATGGCGTCAGTACCCCATCCAGCCCCTATCAAGATGATTGCTAAT
ACGCTGTACAGGGGACTATTTGTATACATTATCCTCAACAGTCTGATCTGGGTGGTTATTCGACTAACGGGAGGAGCGAT
TGAGCCTCGCGAGTATGACTTGAAGGAGTACTGGACTTGGAAGCCGGCCGGGAAGAAGCCAACTGCCTTCCGTCTTTTCT
CACGACGATCATATTGGGGCGGAAAGGAAAGTATCCGTGGAGACAACGAGTCGGCGTTTCCTGGGGGAGATAACGAAGAA
TCATTGCACGATATACACAGTACGTCGGCCGGCGGATCAACAGAAATTGGTGATCGGGTGGCCGGCTCTGTGGCAGCTCC
GAAGCCAGCTTTAATGGCTACGAACCATGCCGGTTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62