GenePrediction:GLEAN_4685 Details

Name: GLEAN_4685
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1050274..1049269 (- strand)
Length: 1006
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1050274..1050026 (- strand)
Length: 249
Type: CDS
Source: GLEAN
Position: GCSC_167:1049864..1049547 (- strand)
Length: 318
Type: CDS
Source: GLEAN
Position: GCSC_167:1049445..1049269 (- strand)
Length: 177
>GLEAN_4685 class=GenePrediction position=GCSC_167:1050274..1049269 (- strand)
ATGGCTTCCTCCAAGATGGCCATTATGACGCCTGAATTTCTGGAAGCCATTGCAAGCCAGCGGGATCTGCCAAAGTACAC
GTGGTACTTTATAGCGTCGACAGTCTTGTGCGTCCTAAATCGGCCACAGGAAATTCAAAGAGTGTATCTTTACGCCATCG
AGCATGCATCGAACGAGGAGCAGCTGCATGTATCGCGACGCATGCGTGACGCACTTATAAAGACAGCAGCAGTCGGTGGA
ATGCCCAAGGTAAATTGATCTCAAGATGTGTGGGTTTTTGAGTAGTCTTTTGTGGTTGGTCACAGTTGAGAGGTGCAGTA
TATGATGCAGATGCAGTCTGATAGATTGCCCGTCTGATTTCTGTCAAAAATGTGTCTGATTGTCTGACTGTCTGTAAACC
GGCCTAGCAGACGATCAATGCCATGATGGAGCTGGCCACGGTGACCCCAGACGACCTTGTCGATGCGCCAATAGGCTTTT
CGCCGGCGTCTCGTTCCGGTGACCTCTGTTATACCTCATCGGCGCAAATTCTGCAGCGTGGCCAGTCCTTCTTCAACAGG
ATCTACGGAAAGGTGGCCACGAGAGTCATGGGACAGATGGATCGCTGTGGCACGCCCGATCTAAGCTTGACGGCACAGCT
TGCATACGGGTACGTGTTGAGCAACACGGACATTCTGAACTCAGCCGAGACATCCTTTGTGATGATTGCCGGTCTCATTC
CCCAAGATGTGAGTTGGGAAAAGAAAGCATGTCTGGACGACAGAGACGGTGCCTAGAAGAAGATCAAAGGAAATCAATAC
GATTCGGCTGATACAACAATCTGTACCAGGTCAATCCCCAGCTCAAGGGTCATCTCAAAGGTGCGCTCAATGGCGGCGCC
ACAGTGGCAGAGGTCATGGCCGTACGGCACGTAGCCATTGAGATTTGCAAAGCCGCCGACATGGTGATGCTCAATGACGA
CGACGTGGGCAGCTGGGGCTGGCGCAGTGCGGTTTCCGGCCTTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62