GenePrediction:GLEAN_4686 Details

Name: GLEAN_4686
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1036324..1034380 (- strand)
Length: 1945
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1036324..1035826 (- strand)
Length: 499
Type: CDS
Source: GLEAN
Position: GCSC_167:1035758..1034380 (- strand)
Length: 1379
>GLEAN_4686 class=GenePrediction position=GCSC_167:1036324..1034380 (- strand)
ATGCGCAGTGGATCAGAGGATTTCAACTCGCTATACCCCGAACCCCCCCAGGGAGTGTTTCCCTCGCCCTCCTTGACCAT
GAACCACCACATGTCCCCCGACGGCTTCTTTCGAAGACAGGACTGCTATCCCACCAACACCGTGGCATACAACCATCCTG
GCGCCACTCTCTACACAGACGCTCCGTTCCATCCTAGCATGTTTGGCGATCGCTTGTCGCCGACAATGTACGCCGACGAT
CAAGACGTCCACCTGTCGTCGTCAAGCCTGTCCACCACCTCGGGCGCCTCTGCACCCTCATCTGCCGTTGGCTCTCCTCG
CTCCAACCACGATCACCCTCCCACTATCACTGAGTGGCCTGCGCCGCACTGCCTGAGCGTCAGCCCCGGTATTGTTGGCC
ACAACGACTTCTTTGTGCCCAGCGAGTACAGCTACCCCACTAGCAACATGGAAGAGTTTGCCCAGTTCGAGTTCGCACAC
GGCAAGCCGTCCTATGTTCGTAAGTCGTCAACCAGCATGAATTATCATATCAGCTAAGTGTCAGGGTGCTAACACTTTCA
TCACAGCGGACCCGTCTGTTCTGCATCCTGAGGTTCGACACATGGGCATTCCTACCTACGACGCCTTTGCGCCGCATACC
CACCAGACGGCTTACACCGTCTCGCCAGAGCACTCCCCCGAGCTGAAGGCTGGCTCCGTCTCTCCCTACCCCAACAGCAC
CAGCACCTACCCCCACTTCAGCAGCCCGTTCCTGGCACCCACTCCAATGGAGGTCCAGAGCAGACGGGGCAGCCGCAGCT
CTTTCTCGGGCTTTCCGTCGGAGCCCCAGCTCTCCGACGGCGAGGGAAAGGAGAAGCAGCGGTGTCCGCACCCTGACTGC
GGCCGGCGGTACAAGGATCTGCGCGCTCACATGCTCACTCACCAGAATGAGCGGCCAGAGAAGTGCCCTATCCAGACCTG
TGAATACCACGTCAAGGGTTTTGCACGCAAGTACGACAAGAACCGCCACACTCTCACGCACTACAAAGGCACTATGGTGT
GCGGTTTCTGCCCTGGGTCTGGATCTCCGGCAGAGAAGTCGTTTAACCGTGCCGATGTGTTCAAGCGCCATCTGACAGCC
GTCCATGGCGTTGAGCAGACGCCTCCCAACAGCCGCAAGAAGACGACACCCGGTGGCAACGTCGCACAGAAGCTGACCAT
GTACGCGCCAGACGCAACGGGCAAGTGCAGCACTTGCTCTCAGACCTTTTCCAACGCACAGGAGTTTTACGAGCATCTGG
ACGACTGTGTGCTGCGCATTGTGCAGCAGGAGGACCCCGCTGAAGCTGTTAATGCTTCCCACCTGGCAGAGGTTGAGAAC
GACGCGGAGCTGATGGAGACCTTGGAGAAGAACCAGCTGCCAACGACGCCGGCTGGCGTTCAACCTGTCGGCGACGGAGA
AGAGGACGACGATATGGAGGAAGAGGACGGCGACGAGGATGCCTCCAGAGACGATGGCTCCTTCAACGGGCCGTTGGGAT
CGCCCCGCAAATCAAAGGGCAACCCGGTAAACGGTGTCCAGAAGTCGCGTGGCATGACTCACTCCCGTGGTGGTGTTCCC
TTCACAGGCAAGACGCGGTCACGGCGCAGCCGCCAGAACTACCCTAGCTCGTGGGGCTTTGACAAGGGCCAGATGACGAT
GCGGAAGCGCGTCATGACCGTCTTTGCGGGACCCCGGCGCCTGGCCAAGGATGACATGATGCTGTCTACTGAGCACGAGA
TCCGCCTCAAGCTTTCGGATGGCAAGGCCTATGTCACCGACTTGGACGTGCAAACGATGAAGCGTGCGGAAGGCTTTTTG
CAGTCCACCGAAGAGGAGAAGGGTCTCTGGGTCTCTGACGACCCAACTGAGGAGCAGACCCGGGAGATGCAGGCAGCGCA
GGTGGTGGCCTCTACCATCATGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62