GenePrediction:GLEAN_4687 Details

Name: GLEAN_4687
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1030151..1029144 (- strand)
Length: 1008
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1030151..1030149 (- strand)
Length: 3
Type: CDS
Source: GLEAN
Position: GCSC_167:1029776..1029375 (- strand)
Length: 402
Type: CDS
Source: GLEAN
Position: GCSC_167:1029296..1029144 (- strand)
Length: 153
>GLEAN_4687 class=GenePrediction position=GCSC_167:1030151..1029144 (- strand)
ATGGTAAGTTTTATCTGCAGAAAATATTGTTTGCGGGATCATCACGGCAGGTCGTCTGTGTGCGTCAAAAGGAGGTTGCG
GGTGAGAATGTGCGGCAACGACAATTGGGCAGTTTCTTCGCGACGACGACAAAAGAGTCACGACCAAAAACCGAGGTGTA
TCGACGACAAAGCGAATAACGAGTGGCATTTGTACTGCTACGTGCAGAATAGAGCGCCAATGTCCCACATATACTCCCAC
GCCCCGTTCTCGTCTGCCATCCATTGAATCTGTCACAGCTGAAAGAGGGGGAAACATGGATGAAGCCGCGGACAATTGTT
CTTGCTGCACGAAGAAATGGTCATGGCTGACACTGTCTCTCTTTCTCTTGCACAGGTTCGCTACGCTGCGACGGAGATTG
CTCCCGCCAAGTCGGCCCGCGCTCGCGGTGCCTACCTGCGCGTCTCTTTCAAGAACACCCGCGAGACGGCCCAGGCCATC
AACGGCTGGAAGCTACAGCGCGCCCTTACCTTCCTCGAGAACGTCAAGACCAAGACCGAGGCCGTCCCCATGCGCCGGTA
CGCCGGCAGCACCGGTCGGACCGCCCAGGGCAAGCAGTTTGGTGTGACCAAGGCTCGCTGGCCCACCAAGTCTGCCGAGT
TCCTGCTCGGCCTGCTGAAGAACGCTGAGGCCAACGCGGACGCCAAGGGCCTGGACACCAGCAACTTGGTGGTGAAGCAC
ATCCAGGTCAACCAGGCCCCCAAGCAGCGGCGGCGGACGTACCGTGCTCACGGTCGGGTATGTGATTCTCCTGCTCAGCG
CTCATCTGTCCTGTCTTTTGGTCTCCTCGCGCTCTCGTGCTGACAATTGCACCAGATCAACCCCTACATGTCGAACCCAT
GCCACATTGAGCTCATCCTGACCGAGGCCGAGGAGACCGTCGCCAAGGCTGAGGTCGTTGGCGCAAACGAGCACCTCAGC
TCAAGACAGCGTGGCGTGCGCGTCCGCAAGGCCCTGACTGCCGCATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62