GenePrediction:GLEAN_4688 Details

Name: GLEAN_4688
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1024401..1022383 (- strand)
Length: 2019
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1024401..1024233 (- strand)
Length: 169
Type: CDS
Source: GLEAN
Position: GCSC_167:1024085..1022383 (- strand)
Length: 1703
>GLEAN_4688 class=GenePrediction position=GCSC_167:1024401..1022383 (- strand)
ATGGACATTCGATCAGCGGCAACGGCCGATAGCACAACTCGAGAAAGCGAAAGCGACGAGGAGGCTGAAGAAGAGAAACG
AGACTATAAAATGCAACGAAGAAAAAGCACCGGAGATGTACCGATCGCTGTAGAACGTGGCAAAGGTGTGGGGTCGTTTC
GACAGTGGAGTACGTGATCCCTCAGCTATTGACTCGTTGCTTTGGGAGAAGGGCAAAGGCTTTACATAGAGGCGTGCTGG
TGCCAGCGGCGTTGGGCCATGAATGAAGACGTGCGACACGTGTCTGGATGTTGACATCACTGACGCGCATGCTTAGCACC
TTTGGCCGCGATGCAAGAGAACAACAAGCGTAACATGGACGATACCGTATTGCACGGCGAAAATGTTGCGAGCCGTCCAG
ATGGCCTTATTACTCCCATTCCGATGTCGTCAACTCTGCGCATTTCCGAAAGCCACAAGGCGCTCGGTCATCCCTCCACT
CCTCCAGCCTCACTTGACAACGCTTCCATCCCCCCTCTGGCAGTGGATGCCCCAGATATGGATAAGACAGCGGAACTTGT
AACACTGTGGTCCAAAATCAGCACTGCGCAGCTACGAAGCGGACAATGCCGAAAGACCATGGCCGAAATGCGGGTGCAAA
TGAGGGCACTTCGACAGCAGAGACGAGAAATGGAGAATCGCTTCACAGAAATGGAACATGACTTACCCAAGAGTCTGCAT
ACAAATTTAATTAACTCCTCACGAGAATTGCAAAAGAAATACGACTCTGCTGAGTCTAAGTATGAGGTTTTAGAGACGGA
GTTGGAGGAGTTGGAGGCAGTTAATCAGGATGCCGAGGTCAAATTACTTCGACTGTTGCTTGTCGGTCATCCGGCAGAGG
ATGCCATTTTTAAAACCCTCGCCGACAGAAACATGGCTACCCGAACAGAAGGAGATACATCAGTTACTAACGATAATAGC
AGAGAGCAAAGGGAGACGGGATGTCTTCCAAATGGCCACGGATCTTTTACGATGAACATTTCTTACCCCAAACCGACCAA
GGACCCTTCTTTGGATGAACCCTTACTTATGGGAATATCTGGAGACCGGTACTCGGATATCCATCCTCTATATGCAGAAC
TCATTCACGCCATCGGGGACCACCAGATGGCAGACGAGGGCGTTTCTGAATTACTTTTAGAGCGCGACATTATTTTAGGC
GAGCTGCAAACGAAATTACTATTGGAACGCATCCAACAAGGCAATATGTACATGAGCGAGAAGGAACTCGAGGCCTTAAA
AACGAGCTTGTCTAAATCAAGTCCTGCTTCTCTCGCCGAAAACTACGCGTCCTTTATGGGAGCGCAAGATGCAGCCTTTT
TACGGCAATTCGACAGCAAACTGGACGCTTCCTTGGACGAGCTCAATTACCAAGAGTCGAGGATCAGCACGTTGCGTGAA
GTCTGCATTGCCACTGGAGCCATGAGGAGAAATATGCCGTACAGAGAGGAGTATGCTATTTGGGGTCAGACTGCCGGTGT
TGAAAATGACGACCTGGTGCAAATGGCCATGGCGGACGCACCGCCACAAGGGACAATGGACCCAAATGCCCTCACACACC
CATATTTCCCTATTCTGTTATCCAGTCCCAAGCACCTGCTTGAGGTGGAGCCTCTCACGGCCAAGGCGGCGCTGCAGAGG
GCACTGAAACTCCCTGCAGACTACCCGATGCGGGAGCTGATGGTGCAGGAAAAAGTCAAGGAATACGGAATTTCCACCGC
GTTGACACGATTTAAGGAAGGGCACAAGACGGATTTCATCAATCGCTGGCTGCTACAACGTCTCCGCATCTCTCCCCTAG
AGGTGGAACTCCTCTACTCTCTCTTCAAAATGAGACTCGAAGTGCTGAACTATACGCAGTGGCAAACGGATGTTCTCCGT
TTCTGGACGGAGGATGGCCTCCAGTCTGCATCTGGCCCGGTGACGGCCTGCGCCTCGGTTCCTTCAATATCTTCGGAGGA
AGCAGTTCGCACCTTTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62