GenePrediction:GLEAN_4689 Details

Name: GLEAN_4689
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1019827..1017936 (- strand)
Length: 1892
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1019827..1019540 (- strand)
Length: 288
Type: CDS
Source: GLEAN
Position: GCSC_167:1019476..1019351 (- strand)
Length: 126
Type: CDS
Source: GLEAN
Position: GCSC_167:1019288..1019129 (- strand)
Length: 160
Type: CDS
Source: GLEAN
Position: GCSC_167:1019072..1018464 (- strand)
Length: 609
Type: CDS
Source: GLEAN
Position: GCSC_167:1018399..1018247 (- strand)
Length: 153
Type: CDS
Source: GLEAN
Position: GCSC_167:1018204..1017936 (- strand)
Length: 269
>GLEAN_4689 class=GenePrediction position=GCSC_167:1019827..1017936 (- strand)
ATGTCGAACTGTACTGCCACGCCAACCTCTTTCTTCCTACAGAAATACAATATATTCAGCAAAATAGACTCCTGCTTGGA
TAGATCTATAGCGGTCCGTGCAATTATCGCCACACCCACGTGGCCCACTGGCCGTCTTTCCTGCTATGTCGCGGCCGCTT
GCGTGTTGCTAGCAGTGTACATTATCCGCCCAGCCGAGCAGCAGAAACCAAACTTCCCGTTTTACAAGGCGGCAAAGGCA
AAATGGATTTTTGACGCAGAAATACTGATTCGACACAGTTACAACAAAGTTCGCTCATTTCTTGCAGACACCCGTGGCTT
GTTTCAAGCAGCTGACCTCACCTCTGCTCAGTTCTATGATCGAGTATATCAAATCAAGGCTACGGAAGGACTGCAAGTCC
TTATCCCGGCCAGGTTCATAAGCGAGCTGAAGGGCTTGCCCGAGCATATATTGAGCGCCACCGAGGCTGTCAACGATGTA
AATAGGGTCGACCGATTGCCTTTCCTCACATCACCAAGCTTCCAAGCTAACTCGTGAAGGCTATGCTGAGCAAATACACA
AAATTCAGCCTCGGCCACAATGGGGACATGCTTTCTGCCGTCATCCGCACCAAGCTGACGCAGAACTTGGCCCGCCTGGT
ACCTCAACTGCGGAAAGAGATTGAGTATGTCGTGGCTACGGAGTTCCCCACGTGTGACGGTGCGTTCTGAATCCTGCTAG
TGCTCGCAGTCTGGCCGGACTGTCCCTGACCAAAGCTGCAGACTGGACGCCCGTCAAGGTGCATCCGTTCGGCCTCCGGG
CTATAGCCCGCCTCAGCGGCCGTGCCTTTGTCGGTTTGTCCATTAGCCGCAAGGAGGAGTGGATGGACACAAGCATCAAC
TTTGCCATTCACGTCTTTATGGCTGTCATCAGGCTGCAGTTCATCCCGTCCTGGCTGCGTCCCATCGGCCAGTATCTTGT
CACAGACCTGCGCCGGATCCGCGCCGATATCACTCGCGGCCAGGCTATGCTGCAGCCTATCATCGAGGAGCGTCTGCGCG
ATATGGACACTCCGGGGTATGAGAAGCCTGATGATCTGATCCAATGGCTTCTCGACACGCTTCCGCCTAGCGAGCGCCAT
GACTACCGTGCCCAGACTGAAATGCAGCTGGTGCTGAGCGCTGCATCCATCCATACGACTAACAACCTGCTGGCAGACTG
CATTTTCGACCTGGCTGCATACCCGGGTGTGCAGGACGCGTTGCGCCAGGAATCAATTGAAGTGTTGTGTAACGATGAGG
CCTGGGCACGCAAGGACAGTTTGGCGCGCCTCAAGAAGATGGATAGCTTCATCAAAGAGGTGCAGCGAGTTTCGGGCAAC
ATAAGTAGGTTGATGAATGCCGATTCTTTATCCTACCCCCTGGATACACTTGCTAACGGGCTGCTCAGCTGGATTCATTC
GCAAGGTCATGCGTCCAATCGTCCTCTCTGACGGAACTCACCTGCCATCCGGCACAAGGCTTTTGGCACCGCAAGCGGGA
TACTCACAAGACGAGCGTTTTTACCCGGGTGCCGACGTGTTTGACCCAATGCGATTTTTCCGCTTGCGCCAGCAACAGCA
ACAGTCCGATTCGAAACTGAGAGAACAGCGGAGCGGACACCAGTTTCACTTTACGTCCATTGGTGACGCAAATATGAACT
TTGGCGCCGGCAAGCACGCGTGTCCTGGCCGCTTCTTTGCGGGCAACGAGATCAAGATGATGTTGGCATACTACCTTATC
AACTTTGAAATGAAACTACAGCAAGGCCAAAGGCGACCATATCCCATGATGGTGATGATGTCCAAGACCCCTGACCCGAA
CGGCGAGGTGCTGTTTCGGCGACGAACGGTGGACCGGGTTGATGGCGATTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62