GenePrediction:GLEAN_4691 Details

Name: GLEAN_4691
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:995969..995296 (- strand)
Length: 674
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:995969..995673 (- strand)
Length: 297
Type: CDS
Source: GLEAN
Position: GCSC_167:995613..995296 (- strand)
Length: 318
>GLEAN_4691 class=GenePrediction position=GCSC_167:995969..995296 (- strand)
ATGGCGACCAACAAAGCCGACGGTCTGCTGCAGCTGTTCAAGGAGCGCCGCAGCTACTATGTGCTCACCAAGGACCTGAC
CGTGTCCAAGGACCGGGTGCAGGAGATTGTCAAGGAGGCGCTGGCCCAGGTGCCCAGCAGCTTCAACTCGCAGTCCAACC
GGGTGGTCGTCCTCTTCGGCGCCGAGCACGAGAAGCTCTGGGACATCACGTCGGACGTGCTCAAGCCCATCGTGCCTGCT
GACGGCTGGGAGGCCACCGCTGGCAAGCTGGCCCTGTTCAAGGGTGCTGCCGGCAGCGTACGTCTACTCTGTTTTTGTTT
TTGTTTTTGTTTCTGCTGCACGGCTGACCGGAATAGGTCCTCTTCTTCGAAGACGAGGCCTCCGTCAAGGAGCTCCAGAC
CAAGTTCGCCCTGTACGCCGACCGCTTCCCTGCCTGGGCCACACAGTCTATCGGTATGCTCGAGTTCGGCGTTTGGACCG
CCCTCGAGGCCGAGGGTCTGGGCGGCAACCTGCAGCACTACAACCCCCTCATTGACGCCAAGGTGGCCGAGACCTGGAAC
GTCCCGACGTCCTGGAAGCTCAACGCCCAGCTGGTCTTTGGCGGTCGCGGCGCCGAGGCTGGCCCGAAGGAGTTCAAGCC
CATTGCCGACATCTACAAGGTGTACGGCGCGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62