GenePrediction:GLEAN_4692 Details

Name: GLEAN_4692
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:992544..990486 (- strand)
Length: 2059
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:992544..992269 (- strand)
Length: 276
Type: CDS
Source: GLEAN
Position: GCSC_167:992204..991512 (- strand)
Length: 693
Type: CDS
Source: GLEAN
Position: GCSC_167:991202..990486 (- strand)
Length: 717
>GLEAN_4692 class=GenePrediction position=GCSC_167:992544..990486 (- strand)
ATGGTCGAATCTGCAGCTCCCGCAGCTGTCCCGGCTGACCCGACAGAAAAGTCGGCTGAGCAGACGGTCGATTTGCGTCT
AATCTCACCATCATGGGAGACGGCAGACTCTCCTCTTCTCGCTGGCCTGTCGGCGTCTACCACGATCGGCCAGTTGAAGG
AGCGCGTGCAGGAGGAGGTGACCACTCGTGGTCGCTCGTGGCAGGGAATGCGCCTCATCCACCGAGGACGAGTCCTGGAA
GGCGATGCCAGAACCCTGGCAGATGTGTTTGGCCCGGTACGATAAGATACCTTGCCGTTAGCTTTTCCAAGGCTGGAAGT
CGTCTTGCTGACTTGCCTAGAACCCGGAACCCGGCGCACTGGCTGTGCATCTTGTTCTCAGAGACCCTGGCAGCAATTCG
ACTGCTCAGCCTGCCTCGACCATGCCGACCGCTCCATCCTCCCAAGCCGCCGCCACGGCTCCGCCGACAGCGACCATCCC
TCGACTGAGCCACCAGCAACATGTGGCCAACCAGGCACAGGCACAGGCACAGGCAGCCGCAGTTGCAGCTGCTGCTGCCA
CGGCTGCAGCCACTGCCAATGCTCGCTGGATGCACCACTTTTCGGCCTTGAACAACATGCAGCAAGGCGTGCCCATGCCC
GCGCCCACCCCGTCGCAGCAGCGGTGGTCACCGGGGATGCCAGGCCAGCCCGTTCACAATACCGCCCCTACTGCTCACGG
CCAGACGGCCGGAGGCCATCCTTCCCAGGAGCAAGGACAGCCGTCTGCGGCCGAGGTGGCGGGATTGTTCACTACGACAA
ACGTGACGGTTCAGAATGCCGGCGGGCGTAATACGGTTACTTATTCAACAACAACCAATTTGCCGGCGAGAGCTGCAGCT
CCACAGCCGCAGGAGGCTTACATCCTGTCGTCTCCTGCGGGGCCAAGGGCTCTTCTGGTCCATGGCGACGCAGAGTTGTA
CCTGGCGCGGAATGCGTCTGCTCCGGCTGCTAGCAACCAGGGAACTGGCACGCTGAGTTCCGGCGAAACGTGGGTGCAAT
TGTTTCGCCGAAATAACCAGCTTGTTACATATGTTCTGCAGCAGCAGCAAGGGTTGCAGCTCCAGATTCAGCAGATCCAC
CAACGGAACCTGCATCTGCAACACATGCTGCAGCAGAACCAACAACAGCTGCAACAGCTGCAGTTCGACCAGGGCCGGCA
TCAACTCTACCAGCAGTATATGTCTCAACAACAACAACAGCAGCAGCAGCAGCAGCAGCAGCAGCCACAACATCCGCGAC
AGCAGCAACAGCAGCAGCAAAATGGGCAAAATGGGCCCGTGGTCAACCCACTTATGTTTCAGGGCGCGCATATGCGGATC
AACAACCCTGGAGCCGGCATGCTAGCAGCCATGGTGCCCCATATATGGCTCGTCGCACGGCTGCTACTGTTTGTTTGGTG
GTTCACGTCGCCTGACGCGAGCTGGACACGATGGTCGATGGTTATACTGCTCGCAACGGCAATGTTTGTGGCTAACACGG
GAATGTTGGACGGAGCGGCGAACCATGTATGGGAGCCGATTCGCCGCCACCTGGACGGTCTTGTGCCAGCAGTGAACGTC
GGCAGGGCACCGGGTGCCAACGTGAACGAGCCGGCGGGTGGACAGCAGGCCGCGGCTGTTGTGCCGGGGAACAACGGTGG
AGGAGCAGGTGGAGAACCGAACCCGGCGCAAATGGCTGCTCGACTAGTGGGGCAACAGAGACAGGCCAATGGAGACTGGC
TGATGGAACAGATCCGGCGTGCGGAGCGGGTGGGCATAATGTTTCTGGCCAGTCTCGCGCCGGGGGTGGCCGAGCGCCAT
GTTGCGTTGGTGGAGCAACGGCAGGCGGAAGCAGAGCGACAGCGGCAGGCAGAACGAGATGCAGCAGAGGCTGCAGCTGC
AGCGGCAGTGGCAGAGGCAGAGACAGAGGCAGCAGCAGCGGCGGAAGGGGCAGATGTAGAGGAAGCGGAGGTCACAGGCG
ACAGTACGGGAATGGATGGGATTGCAGCTACACCAGAGGTGACGACAGCAGCAGAATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62