GenePrediction:GLEAN_4694 Details

Name: GLEAN_4694
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:982346..981849 (- strand)
Length: 498
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:982346..982194 (- strand)
Length: 153
Type: CDS
Source: GLEAN
Position: GCSC_167:982131..981974 (- strand)
Length: 158
Type: CDS
Source: GLEAN
Position: GCSC_167:981915..981849 (- strand)
Length: 67
>GLEAN_4694 class=GenePrediction position=GCSC_167:982346..981849 (- strand)
ATGTCCAAAGAAGCCGTCCGCACTGACAAGGCGCCTGCGCCCGCCCCAATCTACAGCCAGGCAATCAAGGCCAACGGCCT
CATCTTCTGCTCCGGTCAGACCGGCAAAGATGCCACTGGGACATATGTCTCTGGGACGGTCCAGGACCGCACTGTATGTA
GACCCCCAATCGACCCCAAAGGCCTCTCCCTCTCTCTGCTGACACTGCCCGACAGCACCAATGCATAAAGAACCTAGAGG
CTGTCCTGGTGGCCGCGGGCTCCAGTCTCGACAAAGTCGTCGAGGTCAACGTCTTCCTGGCTGATATCGACGACTTTGCC
AAGCTTAACGAAGTCTACATCCAGTATTTCGGCGATGTCAAGCCTGCACGCACGTAAGCATCTCTCTCCCCTGTCTCAGA
CATAAGCTGTTCCTAACCCCTACTTCTCTAGATGCGTCGCTGTTAAGAACCTGCCGGACTACACAGACGTAGAGATCAAG
TGCACTGCCCTGGCATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62