GenePrediction:GLEAN_4695 Details

Name: GLEAN_4695
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:979279..978759 (- strand)
Length: 521
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:979279..979088 (- strand)
Length: 192
Type: CDS
Source: GLEAN
Position: GCSC_167:979037..978759 (- strand)
Length: 279
>GLEAN_4695 class=GenePrediction position=GCSC_167:979279..978759 (- strand)
ATGGAGCAAGGCAGTGCCGAGAGCACGACGGTCTCTTTCGCAACGCTGCTTCCTCGGTCACAAGACACTGAGCTCCATGT
GCGCCTTACGAGCAGGGCCAAGAGCCTGATGGTGTCGGTGGCGACGACCGGCACAGACGAAGGAGACCACGCTCGATCCG
AGCTGGGATCGTTTGTCTATGCTCTTCCAAACGTAATGCCGGCCGGTCCCCCTGTGCTTGCCTTTGCGCTGACAAGTAGC
AGAGATACCAAGCCGGCGACCCGCTGTGCACGACTCTCTACAGCGACGAGAAGTCGCTTGAGTTTGCGGTGCGGCTCGCG
AAGCTGATTGTCAGGAGGACGCAGATGGTAGCCTATGTTTCCACCTCGATCAGTCTTGAGCGCATGGGGCTAGGCGGCAC
GGTGGAAGAAATCCTAGAGGCCTACCAGGCCGTGGTGACCCCGCTGGCGGGATATCTGCCGAAGTCCCAGCCGGCTGTCC
AAACGAACGGTCTGTCCTCATTGGCAGACGAGCAAAGATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62