GenePrediction:GLEAN_4696 Details

Name: GLEAN_4696
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:977611..974645 (- strand)
Length: 2967
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:977611..977510 (- strand)
Length: 102
Type: CDS
Source: GLEAN
Position: GCSC_167:977456..976487 (- strand)
Length: 970
Type: CDS
Source: GLEAN
Position: GCSC_167:976309..974799 (- strand)
Length: 1511
Type: CDS
Source: GLEAN
Position: GCSC_167:974746..974645 (- strand)
Length: 102
>GLEAN_4696 class=GenePrediction position=GCSC_167:977611..974645 (- strand)
ATGGCATGGCAGCCGGCCCCAGAGTCGTTGCGGACGCTCATTGGCTGTCTCAAGGACTCCCATAATGGCTTTGACCTGAC
GGCCCAGAAGCAGGCGGAGATTGTAAGGCCGGTTGCTTTGTATTTTTGTTGTCTTGCGTCTGCTGACACGTGCAGATGCT
CACGCAAGCCAAGAGCTCGCCCGACTTCAGCAACTATCTTGCGTGCATTTTCTCGAGCCCAGCACAGCCAGAGGGCGTCA
GCATGTCTGGCACCGATTACAACGTGGTTCGATATGCGGCGGGCATCATGCTGAAGAACACGGTCAAGACGTCGTATAAG
CAGCTGCTGGAGCCGAGCGTGGCGCTGATCAAGGCAGCCGTGCCGCTCGGGCTGCAGGACGAGAGCCCGCAGGTGCGCAG
CTACGCGGGCAGCATTGCAACGGAGCTGGTTCGCCGCGGCGGACTGTACGCGTGGCCGGAGCTGCTCAACGACCTGCTGG
CGATGGTGGGCAACACGACGGGCCAGGTGTCGGTGGCGGCACAGGAGGGCGCGATGGCGGCCATGACCAAGATCTGCGAG
GACAACGCGAGCCTGCTGGAGCGCGAGCAGAACGGGCAGCGGCCGCTCAATTTTCTGCTGCCGAAGCTAATCGAGGCCTG
TGACAGCCCGCTACCCAAGGTGCGGGCGCAGGCGCTGACGGCGATCAACGAGTTTGTGCCGCACAAGTCGCAGGCGATGC
TGGTCAACATCGACGCGCTGCTGCAGCGGCTCTTTGCGCTGGCGCCGGACCCGAGCTTCGATGTGCGGCGGCAGGTGTGC
CGGGCGTTTGTGTATCTGGTGGAGACGCGGGCAGACAAGCTGCAGCCGCACCTGGCCGGGCTGGTCGACTACATCATCAC
ACAGCAGAAGGACGAGGAGGACGAGGACCTGGCCTGCCAGGCGGCCGAGTTCTGGCTGTCGGCCGGCGAGCACGAGTCGT
TCTGGCGGAGTCTGGTACCGTTCATCCCCAAGATCATTCCAGCCCTGCTGGAGGGAATCGTGTATAGCGGCGAGGATATT
GCGCTGTACGGCAGCGCGTCGGACGACGAGGACGAGGACGACCGACAGGAGGACATCAAGCCGCAGTTCGCCAAGCGCAG
CGGCGGTCGCGTTTCGACGACGGGCGGCGGCTCGACGGCGACGGCGATGAGCGGTGGCCCCGGCAACGGGTACCAGAAGC
TGGACCGCGAGGAGGGCGAGATCGATGAGGAGTCGACGGCAGGCGGCGACAACGACGACGACAACGGTTTCTTTGACGAC
GAGGCCGACCAACGCTGGACAGTGCGCAAAGGCTGTGCGGCGGCGCTGGACGTGTTGTCACGTGACTTTGGAGACGCCAT
GTTCGAGTGCGTGCTGCCGTATCTGACGACGAACCTGCGGCACGCGGACTGGCCGCAGCGCGAGTCAGCCGTGCTAGCAC
TCGGGGCCGTGGCCGAGGGCTGCATGAACGCAGTACGGCCACACCTGCCGCAGCTGGTGCCATACCTGATCACGCTGCTG
AACGACTCGGAGCCACTGGTGCGGCAGATCACGTGCTGGACGCTCTCACGCTACGCACTGTGGGCAGCCGGGCTGCCAGA
CCCGGCCGAGACGACGGCCTTTTTCGAGCCGATGATGGGCGGGCTGCTGCTGCACATGCTGGACCGCAACAAGAAGGTAC
AGGAGGCGGCGGCATCGGCCATGGCCACGCTGGAGGAGCAGGCCGGCAAGACGCTGGAGCCGTATGCAGGACCGATCATC
CAGCAGTACGTGCAGTGCTTTGAAAAGTACAAGGACCGGAACATGTACATCCTGTACGACTGCGTGCAGACGCTGGCGGA
GGCGATCGGGCCTCTGCTGGCCCAGCCAGAGTTGGCAGGCCAGCTGATCCCGGCGCTGTTCCGGCGATACGACAGCGTGC
CGGATGAGTCGCGTGAGCTCTTCCCACTGCTGGAGTGCTTCTCGTACGTGGCCATGTCGCTGGGGCCGGTGTTTGGGCCA
TATGCGCAGCCGGTGTTCCGGCGCTGCGTCACCATCATCCACCAGAACCTGGAGCAGGCGCTGGCGGCGGCAGCCAACGG
CCACGTCGACGCGCCGGACAAGGATTTTCTGGTGACGAGCCTGGACCTGATCAGTGCTATCATCCAGGCGCTGGCCGGTG
GCGGCGAGGCGGGCGCGCTGGTGGCCGACACACAGCCGGCCTTCTTTGAGTTGCTGGGCTTCTGCATGGAGGATCCGAGC
GACGAGGTGCGGCAGTCGGCCTACGCCGTGTTGGGCGACTGCGCCCGCTTCGTCTTTCCGCAGCTGCTACCCTGTCTGGC
CGACGGGCTGCTGCCGATCCTGGTGCGCCAGCTCGAGGTCGACGGCCTGCTGGACGACGAGGCCGACAGCGGCTTCAGCG
TCATCAACAACGCCTGCTGGAGCGCCGGCGAGCTGGCCGTGCAGCTTGGCGATGGCATGCGGCCACACGTCGACTCGCTG
CTCAAGAGCTTCGTCGCCATCCTGACGGACCCTCACGTGCCGCGTGGCGTGAACGAGAACGCAGCGATTGCGCTCGGCCG
CCTCGGGCTCGGCTGCAGCGAGGCCCTCGCGCCCCATCTGCACACCTTTGCCGATGACTTTCTCGCTTCCATGGACGGTG
TCGATCCGACCGACGAGAAGGCTACCGCTTTCAAGGGCTTCACCATGGTCGTGTCCCACAACCCGGCCGCCATGGAAAAA
GTCCTGCTGCATTACTTCCGCTCTATTGCCCGCTACCAGGACATTGCCCTGCTCAACCCCATCAAGCAGGACCTGCACGA
GGTTTTCCAAAATGTGAGTTTTTATTTCGTTTTCTTTCTTCTTTCTCTTAGCACTAACTCCCTAGATCCTCTTCCGGTAC
CGTGAGCTTATTCCCCAGTTCGACACCTTCCTCGCCCAGCTTGACCCGCAAGACGTGGCCGTCCTGAGGACCAGCTACGG
CGTCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62