GenePrediction:GLEAN_4699 Details

Name: GLEAN_4699
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:951143..947262 (- strand)
Length: 3882
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:951143..950216 (- strand)
Length: 928
Type: CDS
Source: GLEAN
Position: GCSC_167:950141..949966 (- strand)
Length: 176
Type: CDS
Source: GLEAN
Position: GCSC_167:949773..948639 (- strand)
Length: 1135
Type: CDS
Source: GLEAN
Position: GCSC_167:948586..947262 (- strand)
Length: 1325
>GLEAN_4699 class=GenePrediction position=GCSC_167:951143..947262 (- strand)
ATGGCGACGGACAGCATGCTGGAACCGGAGGCGGCGGCGGTGGCGGCGGGCGGAGCATCAGCAGCGCGTCAGCGGCCGTC
GAAGCAAGCCAGCCGCAGCACGCGAGCGTTGTTCCCGACGGCGTACAACGGCCAGAAGTGGGCGCGCTTTCTGGACCGGT
GCCTAGCGACGCGGCTCTCGGTCGACCGGTTTACGCAGTTTGCGCCGCTCCAGCAGCGGAAGTACCCGGTGGCGCCGGCG
CTGCTGGCGGATCTTCTGCTGCGGCCGCGAAGCGGCGGCGTCGGGTCCTCGACGACATCAGCGACAGCGACAGCGACAGC
TACATGCGACGCGTTTATCGACCCGCGCATCCCGGCGTATCTGCAGGTGCTGCTGCAGCTCCGGCACGTCGACGTGACCT
CGGTGCTGCAGGCGCTGTACCGCTACTCGACATCGCAACGAGCGGCGCAAAAGTCGGCTCACGTCAAGGGCGAGCAGCAG
CAGCAGCAAGGCGACAGAGACGGAGACGACGACGACGCGAGCGGACCCTTGACGCCGGCGGTCAAGATTGAGCCGGGCAG
CAGGACAGGCGGAGGACCGAGCACACAGACATCAGTCGGCCGGACGGCACTCTGGGGCAACTCGTACGCCAACGAGGAGA
CGACGTTTTATCGGATCACGCGTGCGGTGCGCCAGGGAACGGCTATCCGGAACCACCGTGAGGCGCTGGCGATTGCGCGC
AGCATGGCGGCGTGGATGGACCTCTTCGTGGCGGCGGCGGCCGAGACGACGGTCGGCACGGTGGTCGGCACGGGGGCGCG
CGACCTGACGGCGCAGGAACACATGCAGGAGGAGATGGGGGCAGCACGAGCAGCGTTTGTGATGCTGCTCCTGGCTGTGT
TCGAGAACGAGATCCTGTGTGCGGCCCTGGCGATACCGGCGGTAAAAGGTAAGGAGTGTGTGTGTATATGAAGGCGAAGG
TGAAAGTGAAAGTGAACGTGTGAGTGATGACTAATAATACAGGTGCTAGAAAACTGCTGTCTGCCAGCATAGGCAGCTTC
GTGCCGGTGATCTCGCTCACACCAACACCGATCACGGCGCGGCTGGAGCAGTTCCGTGCCGATACGCTGGGCAGCCTCGA
GCCGGCAGACAAGAAGGAGGCTGAGGCGGCCGACCTGCACGACATAATCAACTCGACGGTAGAGCTGCAGAATCTAGTGC
TGCCTGAGATGCCAACTGCCAACTCGCGGGCGGGGCTTTATATATATCTGAATGCCTGTGTATGTTTTTTATCCTTGTGT
TTCTTTTTTCTTTTTCTTTTTTCTATATTTCCTTCTGTTCTCTCCCCTCCTCCCCTCCCCCCTTCTCCCCTCTTCTACTA
ACTCTCACAGCTCGTCGGCCGGCCACTCATCGACGACACTGCCCTCTTTACATACCTACACAACCGATACCAGGGCGACC
TGCAGACGACGGCGATCGACCTGATCCTGGCGTCGTTTGACGTGCTGGCCAACGCGGTGTTTCGTACGGAGGTTCACACG
TCGGCACACCTGCTGCGATCGTTCCTGCTCAACAAGGTGCCGCTGCTGCTGGCGTCGCTGGCAAGCTCGCCACTGTACCC
GTTCAACGCCGAGTACTGCATCTCGGAGGCGCTGAGCCGGGTGGACACGAACGCGTTTCCGACCATGTCATCGATGTTTG
ACGACAACCAGAACACGACGCCGCTGACGGACAGCGCGCGACAGGACTTTTGCTTTGCGTGTTGCCTGCACGGGCTGATA
GCCGAGACGAGCATCGAGACGCTGCTGGGCGAGATGACGTACCAGACGCTGCCGGACGGCGGACGTTTCACCAAGGAGCG
GCTGGTACAGCAGTGTCTGGGAGGCGGTGGTGGTGGCGGAGACGCCGGACGGATCACGGCGCTGGTGGGCCAGCTGGACA
GCATGGACGGCAACGCAGGAGCGGCATGCCAGGCACTAGTGGCCGTGCTAGGACAGCTGTGCGAACGGCGGGAGACGGCG
ACGCTTAAGGGACTGTGCAACCAGCTGGTGCGCAAGCCGCTGGCTTTTGACGTCGTGCTGCTGTTCGAAAAATTGTCGGC
AATAGTGTGGCCGCTGTGCCGGCTGCTGGACACGTGGCGATACGACGACGACCAGGGCGAGTACCAGCCTGTGTATGAGG
AGTTCGGGGCGGTACTGTTCCTGTTGTTGGCTTTTGTGCATCGCTACGGCCTCTCGGTGGCCGATCTGGGCATCGAGTGG
CCGGCAGACTCGTTTGTGGCGCGGCTGCTGACAAAGGGTCACCTTGGACGCACGCTGGCCGAGATTTCGGAGCAGGAGGG
CGAGAACCTGGGCAACTGGATCCGCGGGCTGTTTGACACGGATGCCGGGGGACTGAGTGACGACCTGATGTCGTCGTGTC
CGCCGCAGCAGTTCTACATGTTGACGCCGACGCTCTTCCAGCAGATTGTGCAGGCGGTGAGCACGAACGCGTTGTCGGAG
GAGATGTTGAAGTGCGGGATAGAGTGTGAGTTTGATGTTCTTGTCTGTGTTGTATGGTTCGCCTGCTGACCGTGCAGACC
TTGTGGACACGTTCCTGCTGCCATCGCTCGTGACGGCGCTGATCTACCTCTCGGACATGCTGCGGGTAGAACGGCTGACG
GAGCAGCGGGCGATCCTGCGGGTGCTGCACTTGATCCTGCAGCCGGCGACGATTTCGAGCGAGGCGGCGACGATGCTGTC
GGCGCTGCTCAATGTGGTGGCGAAGCCGCTGGAGCAGGCACTGCGCACATACCAGCGACAAGACCCCAAGAGCCAGGAGG
TGGACCCGCTGCTGCGGGTGTTGAAGCCCAACATTCCGCGATCGAGGCGGACAGCCGCGGCCGAGCATAACGAGCTGACG
TTTGGCAACACGAGTAACAACGGTGGCCTGGCAGCGGCGGTGCGCCAGACGGTGCAGAGCTTTGTGCAGTGGAGCGTGCA
TCCGGGCGTGAACACGATGCCGACCTGGTACACGCACCGGCAGTTCCTGGCAGCCCTGAGGCTGATGGGCGCGCCACGGC
TGCTGCAGCTGATCCTGGACGACCTGCAGCGTCAGGTAGAGGCCGGCAGTGGCAGCATGGCCTATGATGTGGCCTGTGCC
CTGGTATGTGCGCCAGACGTGACGAACGAGCCATCGCCTGCGATGCTGTATGTGCTGGGAGGAGGGGGAGGAGATCGAGG
CAGCGACAAGCAGCAGAAAAACGACCTGGTGCCGAATCCGGCGACAGTGCAGCGGCGCATGTCATTACGCCAGGCGCTAG
CCTTTCGAGCGGAGGAGTGGAAGCAGATGCAGCGCTCTGGGCGGCCGAGCGAGATGGTCATGGCTGAGACGATTGTGCGG
CTGCACCGTCGTGTCGAGGCTCAGATGGCACCACCGCCGCCAGCAGCCGTGGCAGCCGCGGCGGCTGTCGAGATGGTCGA
TATGACCGATCTGGGCGGCGATCTCGGTGGCAATCTCGGTGGTGATCTCGGTGCCGACCTCACCAGTCACAACCTGGGTG
GGCTCGACGGGACCGACGTCGCGGCGGCTGCAGCAGCCGCTCTCGATGGCGCGGCCATGGACAGCATTGCGGCAGCGGCT
GTTCAGGCTGCAGCAGCTGATGCGGCCGATGCGGCCGATGCCATGACGCTCGACACCACAGCGCCGCCGGCCAGCAGCAA
GACGGCCGCCGGCGCGGCTGTGACCGACCTCGACGATCTCGGCGATCTCGGCGATCTCGGCGATCTCGGCAGCCTCGAGG
GTATGGGCGTTATGGACGGGCTCGGCGATATAGGTGGCGCCAGCGCGGCCGGCAGCCTCGACCTTGGTGACCAGAGCATG
TTTTCGGACCTGGAACTGATATCGTGGATTGACATGCAGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62