GenePrediction:GLEAN_469 Details

Name: GLEAN_469
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:30480..35884 (+ strand)
Length: 5405
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:30480..31463 (+ strand)
Length: 984
Type: CDS
Source: GLEAN
Position: GCSC_97:31818..32782 (+ strand)
Length: 965
Type: CDS
Source: GLEAN
Position: GCSC_97:32838..33003 (+ strand)
Length: 166
Type: CDS
Source: GLEAN
Position: GCSC_97:33074..33307 (+ strand)
Length: 234
Type: CDS
Source: GLEAN
Position: GCSC_97:33363..33473 (+ strand)
Length: 111
Type: CDS
Source: GLEAN
Position: GCSC_97:33539..33616 (+ strand)
Length: 78
Type: CDS
Source: GLEAN
Position: GCSC_97:33990..34206 (+ strand)
Length: 217
Type: CDS
Source: GLEAN
Position: GCSC_97:34291..34728 (+ strand)
Length: 438
Type: CDS
Source: GLEAN
Position: GCSC_97:34812..34928 (+ strand)
Length: 117
Type: CDS
Source: GLEAN
Position: GCSC_97:34995..35884 (+ strand)
Length: 890
>GLEAN_469 class=GenePrediction position=GCSC_97:30480..35884 (+ strand)
ATGTTTGCTTCTATCGCGACCGCCCCGGCCAAACAGTCGGTTAGCGAGACAATATCGGTGCTTAGCGGACGGTTGAGCTC
GGCCACTTTGCTTGAGGATCGCCGAGCAGCCATTCTTGGTCTTCGAAGCTTTGCGAAGGAGTACCCAGCGTCTGTCTCGT
CAGGGGCTCTTCGGAGCTTAATTGGGTGTCTAGCACATGATGGCGAGGATGTCGACACTGTGAAGGTGGTGCTTGAGACG
CTGCTTATGCTCTTCAGTCCCAACGAAGATAGCCCCGAGGCTTCAGAAGAGATCGCCCTTTGGTTGGCGGACGAGTTCAC
ACAGAGGCTGGAGAACATTACTCTGCTTCTTGACTTTCTTGAAACCAACGACTTTTACTCGCGGCTATACTCTTTACAGC
TACTATCTGCTATACTAGCTGCCCGAACGGAACGGACAGAAGAGTGTATATTCACCGCCCCATTAGGTATCTCGCGTCTT
GTCGCTATTCTCGATGACAACAGAGACGTGATACGGAGCGAGGCGATCACGCTTCTCACCTACCTGACACCTTCGTCGCT
GGAGATACAGAAGCTTGTCGCCTTCGAAAATGCATTCGAGAGGATATTTAAGATCATTGAAGGGGAGGGCGGCGTTGCTG
AAGGAGGCCGGGTTGTCGAGGACTGCCTGATTCTCCTGGCCAACCTTTTGCGCATGAACCCTCACAACCAGACACTTTTC
CGAGAGTCTCTGTGTACCGCTGTGCTCTCTAGAATTCTTGGGGAAGTTGCCTCATCAGCCATAGAGCAAGACGAGATGGC
TGGCTGGGCGCAGGCCCAGCGTAATCGGAATGTCTACGCCCTTCTGGCAGTCGTTCGTCTGTTTCTGATGTCTGGTGCGG
TTGGTACAGTACAAAACCAGGCAGAGTTCTGGCGCACTGGCCTTCTCTACCATGCCTTACAACTAGTGTTTATTGGTACT
TTTGAGGTACAAATTCGCGCCGAGGTAAGTAGCGGGAACGCTTTTATAGCGAGAAGTGTGAGTATGTTGTAAGCTAATTC
GTGATATCAGGCTCTTTCAACATGTGCTGCTATTATTCATGGCAATGCGAGTTTGCAGGAGAACTTTGCCCAATTGCGTG
TTCCTTCACCGCTTAATAGCTTTTCAGTCGGAGGCGATACTGAAAATCACAGCGTCGGTAGTTCGCATCTGCCCGATGAA
GTGTTTGTGATCGACGGGCTGCTAGATTTGGCTTTAAGTGTACATGCTCCTCATCTGTTCGATATGAGACTAGCTGCAGC
TGCATGTATGAAGGCGTACTTTTTCGGGCATGAAGTTGTGCGCATGCATTTCTTACAGAGGGCAATCGACGGCCACAATT
CCGGTGCCGACGAAACAGCGAACGTGTTTACTACTCTACTTCGATCACCGACTTCATCTTGCTCTAGCGATCCCTACCGC
CAGTGGTTCGCTGCTGTCATAATGCTCCATTTGCTCTACGATAATTCAAGGGCCAAGGCTTTGGCGATGACGGTGACAGA
AGGAGATGAGGCTAGCGGGGAAGAAGTGGTGACAAGCATTCAAACTGTCACGGCACAACTTCTTGGTAGCATAAGTAGAG
AGGATGATCCGCGGATTGCAGTCGGCTACCTAATGCTACTAATATGCTGGCTGTTTGAGGATCTCGACGGAGTCAACGAC
TTTTTGGGTGAAGGAAGCAATGTTCAGGGCCTGATACAGGTAGTAGTGAAGACTACTGGCAGTGACATTGTCGTTCAAGG
GCTTTGTGCTCTCCTGTTAGGAGTTGTGTACGAGTTTTCTACCAAAGACTCGCCAATTCTTAGGCAGAAGCTGCACGAAG
TGCTTATGGGCCGGATGGGCCGTGATCGGTACGTCGACAGGCTTACCAAACTCAGGGCACATCCATGGCTCAGGGATTTC
GAAGTCACCCCTCAAAGGCTTGATCTCGCGGGGAGCCAGAGACTGCCGGACGTGTACTTTGATATTACGTTTGTCAATTT
CTTCAAAGACAATTACAGCAGGCTTCTTCGCGCCATTGACAGGGACCCGGGGACAGAGATATCGTTCGTGGCCAACGGTG
TCCAGCAAGGCATATCCCGAGAACTGGTGGACTCACTTCGAGCCGAGCTGGGCCAGAAGGATCGTATTTTGGGAGAAGCA
CAGGAGAGATTGTCTTCTCTCGAAAATGCGCTGGGTCAAGAGCGCTCAGATCACAAACGTTCTAAGGAGACCGCTGCCAT
TGATCTCAGTAAGGCCAAGGCTGCGCAAGACCTGTTGTCCCGGAAGCACGAAGAGCAGATGCAGTAAGTGGAGATGCCTG
TAAGACCATGTGTGGACCACCGTCTAATAAATGTGTAGACAAACTCGCGCAGAACGCCAGAAGGAGAAGGCAGACTGGCA
ACGACAAATGGAGCAGGCAAGGAAAGCTGCGGAAGCAGACGCAGCACGAGCTCAGCGGCGTTTTGAGGCAGAAATGGCAG
ACCTCAGAGCTACAAGCAGTCGCCTTGAAGTGGACTTGTTGAAGGTATACGCATTTTACCTGTATACAGGTGCAGGCACT
TCTCATACGTGATTGGGTAACTAACGCGATATAGGCAAACAAGAGCAAGTCCCAGGAGCTGCAAAGCATCCGTGAAACGC
ACAAGGCCCAGCTTACTGAGGCCGAAGCAACAGCCGCTGATGCAGCCCGGCGGATAAAGGCTTTGGAGGGCAAAGTTGCC
ACCGCAGAGAAGAAAGCCGTGGAGCTGAGGGAAGCTCTGGAGACGACCGAAGAACAGAACAGAGAGCTAGCAGAGAGACT
GGATTCTATGGAAAAGGACACGAAGAAGGTAAGCAGTACTACTGCTACTTGCGTCGTGTATAAGATACTGACTTGCCGCA
TAGGTGGAGGCTTTGTTGGTCGAAAGCAAGGAGGAAAAGAAAACGACGCAGGCGGAGTTGGATGATCTTCTCATGGTCTT
TGCGGATCTGGAAGAGAAGGCAAATGGGTATAGGGTGAGTTTGATGCGAATTGGCAACAAGTTGTTTTACACCGCACGCC
TGCTGATCTGTTTGTTTAGGAGCGTCTCAAGGAACTTGGCGAACACGTCTCTGACGACGAGAATGACGAGGAAGACGGGG
ACAGTGACGAAGATGACGTGGATTGATGAGACGGGTGTTGACGAATGTGGCATTCTTCTGTGGGGCAACCGACAGCGACA
TGGAACCCACGAGGTCAGCGAAAGAACCGAATCATTGTCAGCCAATCCTGGATATCGATGTATGCAGCACAGCGACGCAT
TGCATGGACGCTATAGGGTCGCAAACCCCGAGCATTTGAATTGAGATAGATGTAGCACGCATTATTATTACTCGCTGCTT
CTGTGGAGGGGAACAAAAAAGTAGGCTAAAAAAAAATCTAGAATTGGCGGCCTTTTTTTCGGCGGCCACCCACAAACAAA
TCCGCCCTCCAGCATATTGTATTTGAGAAAGCTGTCTCCCCACGTCACGATGACGAATTACAGATCTCAGAGCGGTAGCG
AGTCGTCCGACGAGGAGGGCTGGCTCGACACCAACCCCGGCGACGACGAAGAGCCGCAGGTGGTCATCTCCCTACTGGAT
GACCATGTGTTCCAGGACGCTGCAGCAATGCTTTCATACTGCAAGGATGAGCACAAGTTTGACTTCCTCGCCATTAGAGA
CCGACTAGGCCTAGACTTCTATGGTTGCGTCAAGCTCATTAACTTCAGTGAGTTCCTCCCGACGGGACGAACGGTTTCTG
TTGCAGGAAGGTAACGCGGCATCTAGCTAACCAAAAACTGTCCGTCTGCAGTTCGCCAGCGTGTGCATGAGGGACTGTCT
GTGTCGAATGACTTGCCTGCTGCCGACTTTGACCACGACCAGTATCTCAAGCCGGTGCTCGACAACGACGCCCTCATTTT
CTGCCTAGACAGCCTTCCCGCAGCAGGTCAGCCGCATGATCAAGTTGCAGCAGAGAAGGTCGCTTCAACAGATTCCAACG
AGACAGGGAAGGTTGAAAGCAACGAGTCACTGTCCAAGGATGTCCAACAGAAGAACGAGGTTTTGCAGTCTGAGCTGGAA
ACTCTCACAAAGCAGTTTGAAAACTATCGCCTCGCTGTCCAGAAGACGCTTGATCAGCGATGGGGCACCAACGAGCCAGA
GACGGATGCAAAGAGCTCGCCCGCGAAAGACGGTGCGACCAAGCCGAAGAGTTCATCCGATTACTATTTCGAGTCCTACT
CATACAATGGTGCGTATAGTTTTCTCTTGTTGTTGACCGTCCGGCGGCTGTGCGGTAGAATATGCACAGGGGCTTACATC
GAAACAAAACAGACATCCACGAAACTATGCTGAAAGATGCGGTGCGCACTGATGCATACCGTGATTTCATCTATGGGCAC
AAGCATCTCTTTGCCGGGAAGACTGTGCTTGACATCGGATGTGGAACAGGTAAGCAACTTGTCCTGCGAGAGCGAAAAGA
CATATTTCTTGGCAGTGTCTCTGACATCCCGATAGGTATTTTGAGCATGTTCTGTGCGAAAGCGGGCGCAAAGTTGGTCA
TAGCCGTTGACAGGTCCGAAATCATTAACAAGGCCCGTGAGAACATCTTCAACAACGGACTGAGCGATCAGATCACCTGT
CTTAAGGGCCTTATTGAGGAGGTTGAGCTCCCCGTTCCCAAGGTAGACATTATTGTAAGCGAGTGGATGGGTTACGCTCT
TTTGTACGAGGCCATGCTTCCCAGCGTCATCTACGCCCGAGACAAGTACCTGGTGCCTGGTGGGCTGCTGGTGCCGAGCC
ACGCCTCTCTGTGGGTTGCACCAGTTTGCGACTCGGAGTACGTTTGCGACAGTATCACGTTTTGGCGAGATGTCTACGGC
TTCGATATGAAGGCGATGCAAGCCGGGATTTACGACGATGCGCGAGCAGTGGTCATGCCCTCGAAAAACATTTGCGGCAC
TTCAAGCATGTTCCGGCTATTCGACCTGCACAAGACGACGGTCAGTGATCTGGTCTTTGGTGCCGGCTGGAAGACATCGC
TGTATGAGAACGCGGACTCTCTTGACGGCTTCCTCGTCTGGTTTGACATATACTTCTGCACATCACAAGAGGCGAAGATC
GAACCCGCTGATGCGACGGCCCAGAGCTGGTTGTCCGCTGGCAAGGACCGAGTTGCATTTACCACCGGGCCATTTTCTAA
AGCAACACACTGGAACCAGTGTCTGCTGCTCTTGGAGTCACACTCAAAGCAGTTAGGACATGCAAAAGGCCTCGACCTGT
CAGGCGAGATCTCGTTTGCTGTGGCTCCGGACAACCCGCGAGCCTTGACACTACGGATGAGTTGGACACCAAATTCGGCT
TCTGGCGAAGCTTCTACGCAAAAACAGGCATGGGCGTTGAACTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62