GenePrediction:GLEAN_46 Details

Name: GLEAN_46
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:332077..333246 (+ strand)
Length: 1170
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:332077..332102 (+ strand)
Length: 26
Type: CDS
Source: GLEAN
Position: GCSC_179:332232..332403 (+ strand)
Length: 172
Type: CDS
Source: GLEAN
Position: GCSC_179:332480..332596 (+ strand)
Length: 117
Type: CDS
Source: GLEAN
Position: GCSC_179:332682..332799 (+ strand)
Length: 118
Type: CDS
Source: GLEAN
Position: GCSC_179:332858..332935 (+ strand)
Length: 78
Type: CDS
Source: GLEAN
Position: GCSC_179:333023..333246 (+ strand)
Length: 224
>GLEAN_46 class=GenePrediction position=GCSC_179:332077..333246 (+ strand)
ATGGCCACCGACAGTGACGATGAGTTGTGCGTCCGGACCTAAAAACCTTGAATATGCAGTACGAAAGGAAAAGAAAGAGA
GAAAAATAGGGGGAGACGGGGGGGTAAAACGATAAAAGTCTGTGGACGTAATAGCTAAGTTGCTCGTTGCTCAAGGACCC
TTTCGGCGTCCGCCATGGACGCCCTCCGCGCATTCTATTCCGAGCGAGACGACCACGTGAAGCGCTTTGCCGACCTGCAG
TCGGCGGCCGACGCGGCGGCCGAAGAAAAGCCCGTCGTCCTGAGCATGGACACCTTCACCGAGGACTGGAACAAGTCGCA
GTTTTGGGTGTGTCCTCCTAGCCTTTTGCCTTTTGCTTTTTGCCTCCTGCATCTGTCTTCCTGCTCACACGACTGTCGCC
CAGTACTCGGATGACACGGCCCAGCTGTTGGCCCGCCAGCTGATCCAGGGCACCGACGCGTCGTCGTCCATCGTCGTGAT
CTCGGCGCCGAGCGTCTTTGTCGCGCTCAAGAACCTCGTCGTGAGTAGACAGCCGACAGCAGACAGCGATCCCCTCCGTT
CCTTGCTAAAACCCAGGCTTCTCTCGCCCGCGTCTTTCCCCACAGTCTGCCTTGCCCTCGGACGAGCGTCCGGGCCTCCT
GCTGCTGGAGCACGACGACCGCTTCACCGTCTTCGGCTCCGAGTACATCTTCTACGACTTCAACAAGCCGACCAAGCTTC
CGCGTACGTCCCCAGCCTCCCAGCCCCCCAGAATGGTCCGTCCGGGATCGCTAATCAGCAGGATCAGCCGCCCTGCGCGC
TTCCGCCGACCGCATCGTCTGCGATCCGCCCTTTCTCAGCCAGGACTGCCAGACCAAAGGTACGCTTCTCTCTCGGGTGG
CCTGCTTCTCACTGCTTGCTGCTCGCTGCTCGCTGTGCCGTCTTGCTCACCACTCATCACGCACAGCCGCCCTGACGGTC
CGCTGGCTCAGCAAGCCGACTGCCCGCGTGGCCGTCTCCACCGGCGAGCGCATGGAAAGCCTTGTGACCGACAAGCTCTA
CCGCGCCCAAGGCGTGCGGACGACCTCGTTCGTCCCGCTGCACGCCCACGGACTCGGCAACGACTTTTGCTGCTACGCCA
ACTTTGAGGGTGACGAGTGGACGTGGCTGGCCAAAAAGGCAAAGCCATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62