GenePrediction:GLEAN_4701 Details

Name: GLEAN_4701
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:939274..937026 (- strand)
Length: 2249
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:939274..939049 (- strand)
Length: 226
Type: CDS
Source: GLEAN
Position: GCSC_167:938969..938267 (- strand)
Length: 703
Type: CDS
Source: GLEAN
Position: GCSC_167:938187..937026 (- strand)
Length: 1162
>GLEAN_4701 class=GenePrediction position=GCSC_167:939274..937026 (- strand)
ATGATGGATCAATCTGCAGCCTCTCTCGTCAGCTCTGCCGACAGCAATGCATCGGTGGAGTCTAGCCGGAGCCCCATGCG
GTCCTCTGCAGCAGCCCTTTCTGAGAAGCCTCTGCCGCTGGACCTGACCCATCTGATCTCTGAAGCGACCAAGCTGCGCA
AGGCCAGCCGCATGAAGCAGTACTACAAGTTCTTCCAGATTCCAGGTGCAGGAAACCTGGCAGGTGGTGCGTATCTCCGC
TCTCTCCCCTTTCCCTTTTCTCCTATCCTTACCCTTTCTGATTCTGACTCGAAATGTTTGACCAGGTCTCCCACACGTGA
GCTACTTCCCCTACGACACACTCGAGGCACAGATCGCCCAGCCCGACCGGTGGTTGCCGTCGCCGCAGACCGCCGTGCTC
TCTGATGGCACCAACACCGATGACGAGGACGACGATGCCATCCTGATCACAGGCAAGATGGCCGGCGCCAAGCTGGCCTC
GTCCGTCTCGTCCGCCCGCACAGCCCCGGCCGCCTCGCTGGTCTCACCGCCCAATCGCCTGGCCCCGGTCCATCTCCAGA
TCCCCAAGACCGTGCCGCCCAGTGCCCCCGACAAGAAAATCGATCTGGCTTCAGCCCTGCAATACGGCGGCTCCGACGGT
TACGCGCCGCTGCTCTCGTGGGTCCGCTCGTTTGTCCGCGACCATGTCCACCCGAACGTGCCCTATCGTGGCGGGCCCGA
GGTCATCATGACCGTTGGTGCCACCGACGGCCTGTCCAAGACGCTTGAGCTCTTTGTCAACCGCTGGAACCCGACCCACA
ACGACGTGCGCGACCGGCCCGGCCTGTTGGTCGAGCCGTTTATCTACGGCAACGCCCTCTCCCAGGCCGCCGCCTACGGT
CTGCAGATCGTCACCGTCGAGGCCGACGAGGGCGGCATGCTGGCCTACGGCCCCGGCGGCTTGGAGGATGTGCTGTCCAG
CTGGGATTCCAGCCGCGGCCGACGGCCTCATATGCTGTACAACGTGACGTAAGTTTTGGGTTTCTTCTTTTCATCGTCTT
CCTGTGTCCTTTTCTTTGTCATCTCGTTCTTCTCGGCTGACCGACAGCCTGGGCCACAACCCAACCGGTATCATCCTAAG
CATTGAGCGTCGCCGGGAGCTTTATGCCGTCTGCAGCCGCTTCGACGTTGTTATTATTGAGGATGACCCGTACTGGCACC
TCCAGTATCCGTCTGCTGCCGAGGCTGAGGCCGTGTCACGGAACCTGCCCAGGCCCAAGCCCGCTCCCTTGACCAAGCCC
ATCGGGCCGAACCAGAGGTCTTCGGGCTACGACTTCCTGGACTCGCTGGTGCCGTCGTTCCTCAGCATAGACGTCGACGG
CCGCGTCATCCGCCTGGACACGTTCTCCAAGACGGTGGCGCCCGGCTGCCGTGTTGGCTGGATCACCGCCCAGCCAGACC
TGATCGAAAAATTCGTGCGCATCACCGAGGGCACTACGTCACAGCCGTCGGGTTTTGTGCAATCGCTGCTGTCGGAACTC
GTCCGCGGCCCGACGCCAGCAGCACTGGCAGCAGCGGTGGCAGGCAGCAGCAGTAGCAGCAGGGGTGTCTGGGGCACCAA
GAGAAGCAGCCCCAGCAGTTCCGGCAGCCTAGGCACCAGCAACAGCTTCGCCGGCTGGCAGACCGACGGCTGGGTCCGCT
GGCTAGAGGGCGTGCGCGGCGAGTACGAGCGCCGCATGACGCAGATGTGCACCATCCTCGACGACAACGCCTGCCAGCTA
AAGCAGGGCACGCCGGTGCGGCCGTCCGAAGCCGACTGGGGCGTCATCACCAAGACGAAGCTCTACTCCTTCTCCTGGCC
GCGGGCCGGCATGTTTGTGTGGGTTCGCATGCACTTTGAGACGCATCCGCTGTGGCAGGCTGCACGCTCGGGCAGCGGCG
GCGATATCCTGGATGGACCGGCCATGCAGATGGCCCTGCTGCTCCTGCTCACCAGCAAGCCGCACCTAGTGATCATCAGC
CCCGGCGACATGTTCAGCGCCTCCGACGAGGTGCACGAGGCCCGTGGATGGGCCTACTTCCGCCTATGCTTCGCGGCCGA
GTCGGACGAGAACCTCGTTGCGAGCACGCACCGTCTGGTTGCCGGCATCCAGAAGTTCTGGAAGATCAAGAGGGTTAAGG
AGATTGAAGACCTCTTGGAATCGTCGCCCATCACGGCAGAGGATGCCGCGTCAGTCACCAACCTGGGCGGCCTGGCGATG
GGCTGTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62