GenePrediction:GLEAN_4703 Details

Name: GLEAN_4703
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:927623..927255 (- strand)
Length: 369
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:927623..927479 (- strand)
Length: 145
Type: CDS
Source: GLEAN
Position: GCSC_167:927427..927255 (- strand)
Length: 173
>GLEAN_4703 class=GenePrediction position=GCSC_167:927623..927255 (- strand)
ATGGCGAGCCAGGACGAGCAGGAGCTCAAAGCCGCGCTCTGGTCGGTCGTCGGCGAGATGGTCGACCAAGAGTCCATCAA
GCAGAACCGTAATACGACGCCGCAGTTCATCGGCGCGCTGGCCGACATGGTGTGGACGCAGATCGGTGAGTGAAGGGCGT
CTCGACCTCGATGGAACCCTTTCTGACGTGTCCCAGAATCGGTGGCCCTCGACCTAGAGAGCTTCAGCCGGCATGCCGGC
CGATCGACCGTGACGACCGACGATGTGCTGCTGCTGGCCCGACGGAACGGCGATCTGCACGACCTCCTTAAGGAGCAGGT
CGACGAGCTGCAGGCGGCACGCGCCAAGAAGGGAAAGCAGCGGACCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62