GenePrediction:GLEAN_4704 Details

Name: GLEAN_4704
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:924772..921754 (- strand)
Length: 3019
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:924772..924596 (- strand)
Length: 177
Type: CDS
Source: GLEAN
Position: GCSC_167:924527..924500 (- strand)
Length: 28
Type: CDS
Source: GLEAN
Position: GCSC_167:924443..921754 (- strand)
Length: 2690
>GLEAN_4704 class=GenePrediction position=GCSC_167:924772..921754 (- strand)
ATGGCGACAAAATTGCAGTTCAAGACGACCTTTGAGGCCGAGCAGGTCATCAGGCCCATATACACGGGCGGGTCGGTAGC
GCTGGACAATGGGTCTCGCATCCTGGCGACGACGCTGGGCGAGGATGCCGTCCTGACGGATCTAGCCACAGGCAAGCTAT
TTGCCAAGATTGAAGGGGTGCGTGTGGCCGGCGGCGAACGTGTGTTTTGGGGGGAAGGAGGAGACGATGCTGACTGAATG
ACTAGGACGGCGAGCCGATCTCGACGCTGATATGTGCGTCTTCCTCTGTCATGCTGTTCGAGATCCATGTGCTGACAGTC
GTTTGGCAGTGACCCCGTCGGCCTCGCACCTGATTGTGTGCTCGCGGTCGTTGACGATGCGGATATACCGGCTGCAGGTG
TCGTTGGGAGAGTCGGTGGTGGAGCCGACGCTGGTGCGCACGGTGAAGCCGCATGCGACGCCAGCGGTGGTGCTGGCGGT
CGACCGGACGAGCACGCTGCTGGCCACGGGGGCGGCTGACGGCAACATCAAGGTGTGGGACATCCGCGGCGGCTTTGTGA
CGCACACGTTCCGCGGGCCGAGCGTGCTGGTATCGGCGCTGCACTTTTTCGAGGTGGCCGCAGCCGAAGCAGCAGCAGCA
GCAGCGGGATCCAAGAAGAAGAAGAACAAGGGTAGTCTGAGCCAGGCGGAGGTGGCCACGGTGGCTGCTGGTGCCGAGGG
CAAGGAGGCCGCGGCCGACACGACGACACGGTTCCGTCTCGCGGCCGGCAGCCAGGGCGGCAAGGTGCGCGTGTGGGACC
TGCATCGACGGGTCGTTGTGGCCAATCTGGACGGTCACGTGTCGGACGTGCAGGCGGTGGCGTATTCGGCCGTGCACCAG
ACGCTGCTGACGGCGGGCCGCGACAAGACGATGATCTGGTGGGACGCGCAGACGTGGACGTCGCGGCGGGTGGTGCCGAC
CTTTGAGATGATCGAGGCAGCCGGCTTTCTGCGCGGCGACAGCGACGACGACAAGGACGGTAGCAGCACGGACGTGCTGG
CCTATACGGCCGGAGCCAACGGCTGCGTGCGGCTGTGGGAGACGCGGACCGGACGCGAGGTCACGGCCGAGCAGCCGACA
CGCTCTGACGAGGAGGCCGTCGTGGCCGCGCTGTATCGGCCGCAGCAGGCCGCGCTGCTTTGCGTGCAGCTGGACCAGAC
GCTGGTGCTGTACCCGATGCCGATGGGCGATTTGCTTAGTAAGCTGAAAAGCAGCGGTGCCGATGGGTTGCTGCCGCCGC
TGGAGACATCGCGACGCATCTCGGGCACGCACGACGACATTATCGACCTGGCATTTCTGCTGCCGGACCGGTCGCTGATG
GCTCTGGCGACCAACTCGGAGGACCTACGGATCGTGTCTGTCGGGGATGCGTCATCGTCGTCGTCGTCGTACTTTGGCCA
GGACGTGGCCCAGCTCAAGGGCCACAGCGACATGGTGATCACGCTGGACGTCGACTGGTCGGGCCACTGGGTGGCGACAG
GGTCCAAGGACAACAACGCGCGTCTGTGGCGGGTGGACGGGCCATCGGGGACGTCGACGTGCCACGCCGTGTTTGCTGGC
CACGCCGAGTCGGTCGGCGCTGTGGGCCTGCCGAAGACGGCACCGGCGGCTGACTCAGCAGAATATACAGACCCGCTATC
CCACCCGCCGGCCTTTTTGGTGACGGGGTCGCAGGACCTGACGATCAAGCGGTGGGAGGTGCCGCGCACGGCGTCAGCGT
CTTCGCAGCAGCGCGCCGTGTTCACGCGCAAGGCCCACGACAAGGACATCAACGCCGTCGACGTGGACGCGCACGGACAG
CTGTTTGCGTCGTCGTCGCAGGACCGCACTGCCAAGATCTGGTCGGTGCGCGAGGGCGAGGTACAGGGCATCCTGCGGGG
ACACCGGCGCGGCGTCTGGTCAGTGCGCTTTGCCCCGGCACACACACCGCCCGTCACGGGCGAGGACGGCACCGCCGTCG
GCGGTGCCGGCAGCAGTCTGCGCAGCCGTTTGGTGCTGACCGGCAGCGCTGACAAGACTGTCAAGATCTGGAGCCTGGCC
GACTACAGCTGCATCCGCACCTTTGAGGGGCACACCAACAGCATCCTCAAGGTCGTCTGGCTGGGCGCCAGTCGTGACAG
CGAGCCCGAACAGGAAGACGGCACCCCCAACGGCCCCGTCCTCTTTGCCAGCGCTGGCTCCGATGGCCTCGTCAAGGTCT
GGGACGCGTCTGCCGGCGAGGCCGCCTGCACGCTCGACAACCACGAGGACCGCGTCTGGGCCCTGGCCGTCCACACCACC
GCCGCCGGCCGCATGCTCGTCTCCGGTGGCGGCGATGCCACCATCACCTTTTGGCGCGACACCACTGCTGTCACCGCGCA
GGCTGCTGTCGAGGCCGTGCGCGAACGCGTCGAGCACGAGCAGCTGCTCGCCAACTACATGCGCCACGGCGCCCTGCGCG
AGGCCGTCACCCTGGCCCTGCAGCTCAATCAGCCCGGACGCCTGCTGGCCGTGCTGTCCGAAGCTATGGTCGCTGCCAAG
ACGACCACTGACGAGGATGCTGACAAAGACGGTCACGTGACTAGATCCGGCGACGACTCCAAAAATATCGCTGCTGTCCT
CGCATCCCTCGACGACGACCAACTCTATACGCTGCTGCTGCGCGTTCGCGACTGGAACACAAATGGACGCTCTGCCGCCG
TTGCCCAGTTCGTTCTCGCCACCCTCGTTCACGCCTATCCGGCCGCCACACTCGCCGGCCTCGCCCGCCGCAGACCCGCA
GACCCGACCGCCGAATCCGCCCCCAAAGGCCCTCGGAACATCAAGGACGTCCTCGATGCCCTCCTTGCCTACACTCAACG
TCATTACCGCCGCACCGCCGAGCTGCTCGATGAGAGCTACCTTGTCGACTACACCCTGCGCGAGATGGACGCCCTGCAGG
CTCTGCCGCCGCCGGATGTGTCTGCCGATTTGGCCGTCGATGTTGCCATGACCGATTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62