GenePrediction:GLEAN_4706 Details

Name: GLEAN_4706
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:905517..905007 (- strand)
Length: 511
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:905517..905325 (- strand)
Length: 193
Type: CDS
Source: GLEAN
Position: GCSC_167:905269..905007 (- strand)
Length: 263
>GLEAN_4706 class=GenePrediction position=GCSC_167:905517..905007 (- strand)
ATGTCGGCCACCTCATCATCTTCATTCCCCCTCGCCACCGAGGACCCGTATACAGGCGGTGGAAGCAGTTCAGCAGACAC
TAGCATCGACAATGACGGGGGTGCGTCCGGGTCTTCTGACGGTAGCATGAGCCTCTCGCGTGGAGGTTTGGTCGCCATCA
TTGTTGTCGTCGTGGCTGTTGCCATAATCGGAGGTGAGCTTGTTGTTCTGTCTGCTCCAGATGTCTTCCTTTGCTCACAC
ACCAGTAGTCACTTCGGCAGTCTTGTTCTATCTCGCCAAGAAGCGAGAGTGGAAGATCCGCCAGAGCATCCGGAAATCTG
CGAGAAGGGTGGTCAACGCCCTGACGCCCCGTCGCAGCGAGTTTCCCAAATCCGCCAAAGAGGGCACTGCCAGCAACTCT
CGTGGCCGTGTCCGCCTAGATGATGTCCCACCCACGCCGCGCTTGCCAGTCGATTTGGAGAAAGGCTTTGCGAACTCCGA
CAAGAAGAAGTACAACTTCCATCGGAAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62