GenePrediction:GLEAN_4707 Details

Name: GLEAN_4707
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:896973..894339 (- strand)
Length: 2635
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:896973..896649 (- strand)
Length: 325
Type: CDS
Source: GLEAN
Position: GCSC_167:896486..895860 (- strand)
Length: 627
Type: CDS
Source: GLEAN
Position: GCSC_167:895777..894339 (- strand)
Length: 1439
>GLEAN_4707 class=GenePrediction position=GCSC_167:896973..894339 (- strand)
ATGTCGCGACATCAGGATTACCGCAACTATGACTACGAACAAGATCTGGGCGAGTATGACGGCGAAGACGAGGGGGATGA
AATGAGCCCGGAAGACCGAGCGCTCTTGGCGCTGAGTGTAGAGGAGGCCACGGAGAGACTGGGCGAAAACGTGAAGAAGG
TGCCGCAAGACAGTATAGCGGAAGCAGTGTACCACTACTACTATGACGTCGACAAGGCGGTTGCATACTTGGTAAAGACA
TTCATCAACCCATCACCAGCACCAGCACCAGCAGCCAAACAAGCCAAACAGGCCAAAGCCAAGGCCAAGCAGGATTCTCC
AGACGGTAAGTATCATGTCTGCCTTTGTCACTGCCTGGCCGGGGATGCGTGCAGAAGAAGAGAGATGGGCCAGGGCCGCA
GACTCGATGTCAACTGTCTGTTCAGCCGAGGGAGTCAAAGCCGAGGGAGCGACAACATGAGCCGACGACATCTGACGCCT
CGCACAGCGAAATCTTCATACGCCAGCTTCTTTGAGGACATGCCATGGCTCGGTGTGCCGCAGTCGAGACAGACCATCTT
TGTGGCACCTTTGCTGCCCAGAGGTGGCCTCTTGGGTGGTGCCAGCGTAGCACCCAAGATGTCGAAGCTTCAGGCTCTGG
CGGCTCAGCGCAAGCGAAAGGCTGAGGAAGCTAAGAAGACCAAAGAGGTTGGCTTTGCAGCCGAAAAGACACAGCCGCAA
GCCAAGGTCGACGAGCATACCAGCAAATCCTTGAAGCTTGCCCTCCGGGCTGTCCGCCAACCTCCGATGCCGACAGAGAA
AGCCGTGACAGAGGCTCCCAAGCCAGCTGAAGCGGAAGCTCCGAAAGTGCCAGCAGCAGAAGCCGTCCCCATGGAGGGGG
TGTGCGGGCCAAGCGGGGCTGCGGTGCACGAGCAGCGCGAGGCAGCCCAGGTAGCGAAGCCATCTGCATTTGCACAGGCG
CTGTTCGGGCCTAAGAAGCGAAAACGGCGCATCTCGGATGTGGCAGAAGGGGGCTTCTTGGCGGTGCCGTCGCTGGCACG
GGCTCCCGCGGCTGCTTTTGAGGCGTTTTTGTCACCGTCTCCCGACGATGTGGTGCTTCAGGCACAGGCGAAAGGTTGGC
GTCGCGGCCAGGCAGCTGCAACTTGATCGGCACGCGTGCGCACTCACGTTTGCCCGAGATTTGCTGACGATTGCAGCTTT
CGGAAAGGCCACCCCCACGGGGACACCGGCGAAAAAGAGGACCGGAGCAGCAGGGGCTGCAGGACAGACGGAATCGACGG
AGGCGACGCTCGCCAACGGGGTGAAGGGGTTGAAGGTGGACGACACGCCGCTGCCGCGGAGCAAGAACCTGGACGTGCTG
GCCGAGTACGAGAAGAGCGCGAAGAAGAAGAACGCGAGCTTTGTGGTGGTGGGCCACGTGGACGCGGGCAAGAGCACGAT
GATGGGACGACTGCTGTTGGAGATGAAGCGGGTGGACAGCCGGACGATCGACAAGTACCGGAAGGCGGCCAAGGACATGG
GCAAGGCGTCGTTTGTGCTGGCATGGGTGCTGGACCAGGGGTCAGACGAGCGGGCGCACGGGGTGACGATCGACATTGCG
ACCAGGCGGTTCGAGACGGCGACGACAGCCTTTACGATGCTAGACGCGCCAGGGCACCGCGACTTCATCCCGAACATGAT
CGCGGGGGCAAGCCAGGCGGACTTTGCGGTGCTGGTGATCGACGCCAGCCGGGGATCGTTTGAGTCGGGACTCAAGGGAC
AGACGCGCGAGCACGCGCTGCTGATGCGCAGCATGGGAGTGACGCGTATCATCGTGGCGGTCAACAAGCTGGACACGGTC
GGCTGGGACCGGGAGCGATTCGAGGCAATTTGCCAGCAGATGGGCGGCTTTCTGTCGGCGACAGGCTTCCAGGCGAAGAA
CATCAGCTTTGTGCCGGTGTCAGGGCTGCATGGAGACAACCTGGTGACGCGATCGACGGCGCCCGAGGCCCAATGGTACG
AGGGGGCAACGCTGGTGGAGGAGCTAGACAGGTCGGAGCCGCTGGCACGGGCGCTGGACAAGCCGCTGCGACTGCCGGTA
GCCGAAGCATTTCGGTCAACAGCTGGGGCCGTCACAGTATCGGGACGCATCGAGGCCGGGTCGCTGCAGGTGGGCGATGC
ACTGCTGGTGCAGCCTGCAGGCGAAAAGGCACACGTGAAGCAGGTGGAGCTGCAAGATGGCAGCAGCAGCGACACACAGA
CGCTGGATTGGGCTGTGGCCGGTCAGAGCGTGATTGTGCATCTGGCCGGCATCGAGGCCGAACACGTGCGACCGGGCGAC
GTGCTCTGCGATCTGACGAAGCCGGTGACCTGCGTGGACGTATTCTCGATCAAGGTGCTCGCGTTTGACATGCTCTTCCC
GATGCCGGTGGAGGTGCACCGCGGGCGGATCAACGAGTCGGCCAAGATCGAGGAGCTGACGGCGCTGCTCAACAAAACCA
GTGGCACGGTCGAGAAGCGGCGGCCCAAAGTAGTCAAGCCCGGGGCCGTGGCACGGCTGCGCGTGCGGCTACACACGAAA
CTGCCACTGGAGCGCGGCCAGCGGATTGTGCTGCGGTCCGAGGGACACACGATTGCGGCAGGGCTGTTGGAATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62