GenePrediction:GLEAN_4708 Details

Name: GLEAN_4708
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:893049..891043 (- strand)
Length: 2007
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:893049..892932 (- strand)
Length: 118
Type: CDS
Source: GLEAN
Position: GCSC_167:892799..891043 (- strand)
Length: 1757
>GLEAN_4708 class=GenePrediction position=GCSC_167:893049..891043 (- strand)
ATGTCGAGACGACCGCCGAATCCGGCTGCTGACCGGGCGGCGCAGAACACGCAGACGATCAAGACGCTGCTGAAGCTGGA
TGCCAACAAGGTGTGCGCGGACTGCAAGAGGAACAAGCGTGAGTGTGGTGTTTTTGGTGTTTTTTGTTGGATCATTGGGG
TGATTGAGGTGATCGGTGTTTGATTCGTATCTGGTGATGTTTGCGTCTGCAATCTTCTCTCTGCCTCATCTACACCTACT
AACGGTCCAGACCCCCGATGGGCCAGCTGGAATCTCGGCGTCTTCATCTGCATCCGCTGCTCGGGCATCCACCGTGGCAT
GGGCACCCACATCAGCCGCGTCAAGTCGGTCGACCTCGACACCTGGACCGACGAACAGCTCCAGAGCATCCTCAGCTGGG
GCAACGCCCGCGCAAACAAGTACTGGGAGCACAAGCTGGCTCCTGGCCACGTTCCCTCCGACTCCAAGATGGAGAATTTT
ATCCGCACAAAGTACGAGTTGAAGCGCTGGGTCATGGACGGGCCTATGCCCAACCCGGCCAGCCTCGATGCCGACGGCGA
CGACGACATTCCCCTTAGCATTGTGAAGGAGAAGCAGAACATTGACCGCAAAGAGTCCATCCGCAAGTCTGTCAGTGGCA
GTGCCTCTGGATCGGCCGCCGCTGAGGCTGCCGCCCGTGCTGCTGCGAGGTCGCGTGCTCCCGTTGTCGACCTGATCGGC
GGCAACGACTCGTTTCCCTCGCCGTCTATCTCGTCGCCACCGCCGCCACCACGCGCAAGCACTGCCGGACCGGCTGCTGC
CCAGGTCGCCCCCAAAGGCATCCCCGTCCCACCCAAAGCGACCACCTCCGCCAGCAGCAACAGTAACAGCAACACCCGAG
ACTCGCTGCTGGGCCTTGACTTCCTGGGCTCGCAGCCCGCCGCCCCGGCTCGGCCCTCCAGCACCGCTGGCTCCACTTCT
GGCGGCGGCCAGTCGCGTCCAGACCTGAAGCAGTCCATCCTCTCGCTCTACGCCACCGCGCCCCGGACACAGCCGGCACA
AGCACATCACGGCGGAGGCAGCGGCAGCTTCGGCAGCCTCCACTCGCCGTCTCAATCCCAAAACTCGTTTGGCAGCGGCG
TTGGCGGTCTCGTCGACCCTTTCAGCAGCCTCAGCTTCGTGACTGCGCCCGCCTCCACGCCCTCGCCGAAGCCTGTCGAC
GCCTTTTCCGGCTTGTCTGGCCTCCACAATCGCCAGAGCTCCACCACCGGCGTCAAGACGGCATCGTCTACTTTTGGCAG
CCTGGGCGGCGGCAGCTTCTTCGAGGCCAAGTCTGCTGCTCCGGCCGTCACATCTCTTCCCAAGCCGGCAGTCGCCTCCT
CGTCCGCGTTTGGCGGCTTCGATGCCTTCTCGTCGGCGCCCTCCTTATCAAAGGCGACGGCAGCAGCAGCAGCAGTCACG
CCAGCCGCGTCATCCAGCGCGTTTGGCGACCTCTTCGACTTCTCGTCTGCCACCTCTGCACCGGCTCCTACCGCGGCACC
TGCGGCTGTCAGCCCGCCGACGGGCGCGTCCAACGCGTTCAGCTCGGTCTTTAACTTGTCGGCCCAGCCGGCCAAGCCTA
CACCCACCGCTGCGGCGCCAGCTGCCAGTCCGCTCGCCGCAGTCAGCGCCAACTGGTCCAACTCGGACGTCTGGGGCGGC
CACGACGGCTGGGGCTCGTCGACAACATCGGCAGCACCGGCAGCCCCGACGGCGACGGCGTCCTATTCCCAACACGTCCA
GCCCAAGGCGCCGGTCAACGACTTCGGGTGGGGCAGCTCTGCGGCCACTACGACGGCCAGCAGCTTTGCCACGCAGAGCA
TCGTGCCGGGGGCCAACGGCAGCTTTGCAACGGCGCCCAAGGTGGCCGCAGACGAGGAGTTTGGAGGATGGACATCTAGC
ACGGCGGTGACGACGACGACGGCGACAGCAAAGCCGGCGGCCGGATTCGGCGGCAGCGAAGACCTGTTTTCCAACGTCTG
GGGCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62