GenePrediction:GLEAN_4709 Details

Name: GLEAN_4709
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:889067..887562 (- strand)
Length: 1506
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:889067..889031 (- strand)
Length: 37
Type: CDS
Source: GLEAN
Position: GCSC_167:888944..888841 (- strand)
Length: 104
Type: CDS
Source: GLEAN
Position: GCSC_167:888777..887720 (- strand)
Length: 1058
Type: CDS
Source: GLEAN
Position: GCSC_167:887625..887562 (- strand)
Length: 64
>GLEAN_4709 class=GenePrediction position=GCSC_167:889067..887562 (- strand)
ATGGGTCTACATAACCCTCTTCCTTCGTCTATGGCGTGTAAGTTACCAGTCAAGCCTCTCCACACCATCTCGTGCATACG
GCGTTTTGGCAGGGTGATGTGTTGATTTTGTTCTTTTATCCAGCGGAGTGTAAAAAGTGCGGAAAGATCCTCGCCTCCTT
CGTCGACCCGCGCCAGGCCTTTGGCCCCGAAAAGGTCATTCCACCAAATGTACTGGCCGGAGCCAAGGTGAGCTTAACAA
CCCATCCCCCTTTGTGTCTCTTGAATAGCACCTAAACGGTGTGTGCGCAGGGTCTTGCCATCCTCACCGTCATAAAAGCT
GGCTTCCTCGGGTCTGCGCGCTTCGGAAGCGGCCTCGTCATCGCGCGATTGCCAGATGGCAGCTGGAGCGCCCCCAGCGC
CATTGCCACAGGAGGTGCCGGTTTCGGCGGCCAGATCGGCTTCGAGCTGACCGACTTCGTCTTTATTCTCAACGACGCCA
GCGCAGTCAAGACGTTTTCACAAGCCGGTTCGCTGACGTTGGGCGGCAACGTGTCGCTCGCCGCAGGTCCTGTTGGCCGC
AATGCCGAGGCTGCCGGAGCAGCCAGTCTCAAGAGCGTGGCCGCCATCTTCAGCTACTCCAAGACCAAAGGCCTGTTCGC
CGGCGTCTCTCTAGAAGGCTCGGCCATCATCGAGCGCAAGGACGCCAATACGAAGCTATACGGCCGACCTATCAGCGCCC
GGGAGCTTCTGAGCGGCAGCGAGCGGTCACCATCCGAGGCTGCGCCGCTGCTCAACATCCTCAACTCGCGCGTCTTCAAC
ATGGGGCGGGGGGGCGGCGACTTTAACGACAGCGCCAGTGTATATAACGACATCCCCGTCTACGATGACCGCTACGACAG
CAGCTCCAACAGCAACCGCAACAGCCGCGGTAGCGTCTACGGCGACCGAAACAGCTACGGCGACCGTAACGGCTACGGCA
ATCGCGGCAGCTACGGCGACGATGCGGTGCGCGACAGCGGCTACGGCAGCCCGACGCGCGATGATGGGTACGGCGTGCCA
CGGCGGGCGGCGACGACGTCATGGCGGGACGACCAGTACGACGACCGCCAGCAGACGCGGCCGTATCGCGGCAGCGTATC
GCGCTCCAACACGTTCAACGACGGCGACAGAAAGATCTCGGGGGCTGGTGCCGGTCCCGGTCGACCAGCAGCGCCGAAGC
CCAACTTTGCTGGCAAGCAGGCGCTCCTTAAGAAGAACGAAGCCGTCGCCCTCTTCACGTTTGAGGCAGACCAGCCGGGT
GACCTACCCTTCAAGAAGGGCGACGTCATCACTGTGCTGAAGAAAACCGAGAGCGACAACGACTGGTGGTATGTTTATGT
TTATTTCTATTTATTTCCCCCTTTTCCTCCCTTTCTTTCTTGTTCTTCTCCTCTCCGAATCCAGAGACTGACAGAACAAC
AGGACGGGAATGATCGGTACGAAACACGGCATATTCCCGAGCAACTACGTCAAGATGAGGGAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62