GenePrediction:GLEAN_470 Details

Name: GLEAN_470
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:40346..42545 (+ strand)
Length: 2200
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:40346..42176 (+ strand)
Length: 1831
Type: CDS
Source: GLEAN
Position: GCSC_97:42238..42545 (+ strand)
Length: 308
>GLEAN_470 class=GenePrediction position=GCSC_97:40346..42545 (+ strand)
ATGACCACGATCGCGTTGACCCGGCCGGTACATCCCCACCATGCCTCTTCGGGTATGTCATCGATCTCCTCATCCATCAC
CCTTGATATGGAGAAAATGGTCAGCCCGGCGCTCCAACCCCAGCCTCCAGCTCCTATTCCAAACAAGCACGTGCCTATTT
GCCCTCCTGGATCCCCACCTCCCGCCGACACTGCAACGACTCCTCCACCGTCTCCACCTGGAAAGAGCAGAAAGCACGGT
GACAGGTCACAACGGTCCATCCTGTTCCCGCCTTCACGGTATCCTCGCGCTGAGCATGGCCGCTTGGCCCTCTATACAAT
CGACGCCGCCGGTGTCGCCTCCGCGTTGGATTACATATCCCGGCAGCCGCTTCCGGACCCATCGCTTGTCTTCCCTTGGT
TCCATGGTCTTCACCCGGACAACTCCATGCAGCAGACATTCTTCTCGCAGCGCAGGCGTCTGCTGAGAAAAACACCTGCC
TGTTTGAGAGGGGTGACCGTCGTTAAGGCAGATAGCCAACTACATATATCTCGCTTGAAGGGTGCCATTGCGCCTGGTGA
ATTCATGCAGCTTGAGCCGACTGCCGAGTTCGTTGACGTTGATCCAAGGGAGGGCTTCTCTGTGCGGAACTTTCAGATCC
AGGCTGCGAAGACCGCCATGACATCTGATATCATAGTATATGGTGATGATAGCGTCGCGGTCGAGAAACTCGGGTGGGAT
ATTGCAGCTGCCCAAAAACGGTGGAGAGACCAGCATGATCTGGACGGTGACCCGCTGCCCATCTACAATACGTTCATATG
CACGGCCACCTTCTCTACCTTCGAAAAAATCCACCCCGGAATTGTGGCTGTCGACTCAAGCGGCCATCTGACTGGAAACG
TGGTCGACTTCTTCCACCAGGAAAGACGGGAGATGTACGCCATGACCATGGCCTCTGAAATCTCACATAATGTCTGGCTT
GGCCCCTCGCCCCAGCGAGGCTCGGAAGAGGAGCTGCGGTATGACATCCTGATCGAGTGCAGTGACATTGGCCGTCTAAA
TCCTGACGCTCTGCATGCACTGGCCAACTTGAATTGTCCGGATGGCCAGCCAATCCATCTGGATTTCCCGTCGTCTGGCA
TTATCCCCCCTCCAACTTGGTCACAAGACGAGGCAGATGCAATCCTGGAAACCTGCAAGTGCATCTACCATCTCGCACAC
GGCATCACTTTGGATCCGTCGACCCTGACCGCCGATAACGTATTGGGATCGGACAATGACACCGTTGGGACAAACGCACT
GGACCCGCTATCTGACGTCCTCAATCTTCGCCCGCGGAGGATACTCATCCACTGCGCGGATGGCTATACCGAATCTACCA
TGCTTGCAATCGCATATTTCAGCTACAGCACTGGACGGCCTGTCCCAGACGCGTGGTTGAATCTCCATACGACTATGCGA
CGCAACTTCTTTGCATATCCCACCGACGTGGCGCTGCTGACGGCCCTTGCACCACGCCTCCTCTGTGCTTCACCAGCATG
CGTTGGAAAGGACCTGGCAGAGATAACCAACATGATACGGGACGAGCCCAGGTGGTTTGCCAATCTGGACGGCTCATTCC
CGAGCAGAGTTCTGGACTACATGTATCTGGGCAACCTCACCCACGCAAACAACCCGGACCTTCTGAGAGCGCTCGGTATC
ACCCAGATCTTGAGTGTAGGGGAGATGGCCATGTGGCGAGAGGGAGAGCTGGAGGAATGGGGAGAAAACAATGTCTGCGC
TGTCCAGGGCGTTCAAGATAACGGGATAGATCCCTTGACGGGAGATTTTGCGCGGTGTCTCGACTTTATCGGTAAGCATA
TTGCTCCTGGGGTCTGTCCGCCTCTTTCGCTAATCACAAATGCTTTATCTAGAGCGCGGCCGTCGCAATGGTACAGCTAC
CCTCGTACACTGTCGTGTCGGTGTGTCCCGAAGTGCTACTATTTGCATCGCCGAAGTTATGCGGTCATTGAAGCTCTCTC
TTCCCCGGGCGTACTGTTTTGTGCGTGCTCGTAGGTTAAATGTTATTATCCAGCCACACCTACGCTTCGCATACGAATTA
CTTAAATGGGAAGAGCTCCAGTATCAACTACAGGGAAGCCGATCTGGCATCAAGAGGGAGCTTGAGTGGGGGGCTATTGC
CCGCGAAGTTGCCCTCATGAACCAGCCATACGTACGATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62