GenePrediction:GLEAN_4710 Details

Name: GLEAN_4710
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:886109..885650 (- strand)
Length: 460
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:886109..885965 (- strand)
Length: 145
Type: CDS
Source: GLEAN
Position: GCSC_167:885804..885650 (- strand)
Length: 155
>GLEAN_4710 class=GenePrediction position=GCSC_167:886109..885650 (- strand)
ATGGGCCACCAAGTTAGCTTCACATTCTTCTTCCAGATCGAGTGCACGGGTGGCCTCCAAACATTCTTGCACCATCTGAT
CTTGCAGGGTTTCCAGAGCCTGGAGAAAATCCAGGCCAGCGTGGAGGGCCTTTTCCGGCTCGGCAGTTGGTGTCTCTGTC
TGCACTTCGGCCTCAACGTTAGATATCACCTTTGTGTCTGCTAATCTTAAGCGGCCAGGTTGACTGAAAGCGTCGGGACC
ATCTGTCCCTCTGATCAGTAGCTGTATGGAATATGAGTGGATTGTCTCAGTTCACTAACTTTCAGTTTGGCTTGGGGTTA
GCGAAATATGCCTAGTGATGGACTGTGGCAGCTCTCTTCTCGGCGGGGGCTTTGACACAGCAGCCGCCGAGGTCATATAT
GCCGCTGGTTGCGAATGGTGCATGGCCTCAGGCTGGGTGGAAAAGGGCGACTGGCTTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62