GenePrediction:GLEAN_4713 Details

Name: GLEAN_4713
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:866135..862109 (- strand)
Length: 4027
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:866135..863146 (- strand)
Length: 2990
Type: CDS
Source: GLEAN
Position: GCSC_167:862991..862109 (- strand)
Length: 883
>GLEAN_4713 class=GenePrediction position=GCSC_167:866135..862109 (- strand)
ATGGCTTCTAGCGCTCCAGCTGCTTCAGATCTCGGAAGTGAGGCATCTGCGGCCCAGAGGCTGCTGCAGAAGCACCAGGT
TACGGTCGAAGAGGTACCCGACGAGGATGACCTGAAGCACGATGCTGCCGTCTCCACTTTGGCGGCCACGGAAGCCGACG
GCTCTGCGGCCAAGCCAGCTGCTGCCGATGGCCCTGTTCCATCCTGGGCGCCCACACCGTCTACCAAGGCTGCCGGCAAG
CAGAAGGAAGCAGAGCCGGTTGCCATGCCGAAGCTGGACACCCAGTCACATGAGCTCTTCCCCGAGCTCGGCGCCCCCAA
GAAGGCGGCCGTCAATGTGGCTCCTATATGGAGCGCCAAGAACGGAGCTGTGGCCAATGGAAACGGCACTGCAACCGGTG
CGTCTAACGGCTCCGCTCGGTCGTCGATGCCTTCGACGCGGGCAGGCACGCCTGCTAATGCGAACGGAGCAGGCTCTCCT
AACGGGCCGCCGTCGTTGTCGATTCCCGGGCGAAACGTGACGACCGTCTTCCTGGACGACTCGCAGATTCTCCCTCGCGG
GGCCCTGAAGCGGCCGATTCCCGACATCATCAAGGATATTAACCGCAAGTCGCGCGCCAACGTCACCATGGCTCCTCCCA
GTGGAGGCAGGAGACGCTTCGACGCTACCGGTCCTCCAGATGTGGCCCAGCAGGCATTGAAGGACCTCATCCAGCAGATC
GGCGCAAAGGTCACGGTCAATGTGCCTATCCCGCAGTCCGTGAGGCCGTTCATCATCGGCAAACAGGGCGCCACTATCAA
GGCTCTCCAGGAGAAGACCGGGGCGCGGATCCAGCTGCCCAAGGCGGAGGACGTTGCGGCGTCTGCGCTGGACGACGACG
ATGACGCGTTGATCGACGTGACGGTGGAGGGTAACACCCTGTCTGCCCGTGCTGCTCACGACGCTATTCTCAAGATTGTG
GGCGAACGCACGGCCAATGTGAGCACCCGTCTCCGCGGTATCCCAGCCGAATTCTACCCCTTCATCGCCGACCCGAGAAA
CGGACTGCTCGCGCAGCTGGAAAACAACGGGGTACAGGTTCGCGTGCCGCCTCTGCAGCCCTGGTCGGCGCAGCCGCCGG
CTGCTCCAGTGGCTGGGTCACGGCCGGTGTTCGTGCCCGCCGCCAACGACAATCACATCCAGCTGGCAGGTGACCGGCTG
GCGGTGCAGAACGCGCGGGCCGACATCGAAAAACTGGCGGAACAGCTTCGCCAGCAGCTCGAACTGCAGCAGACGGCCAT
CCCGAAGGGTCGCCAGCAGTTTATTATCGGCAACCACGGCACGCCTATGGATGAGTTCTTCAACGAGACGGGCTGCGCTA
TCGTGCTACCTACGGACGAAGAGGACGACACAGTGACGATCATCGGCCCTGCAGACCAGGTCAATGCCGGGCTCGACCGG
GCCATTGACCTGGCCATGGGCATGCAGTGCTCGAACTACGACATCTCGCGGTTTCACCGGCAGGTCCCGGGCAGTGCTAC
TGCCCACGCCCGGAACGTGACGCGGTATCTGCGGGAGCGGCTCGAGATTGAGCGGCTCGAGAAGGAGTACCAGGCGCACA
TCAACACGCCGTTTACGAGCGAGGGTGCACTGCCGTGGGAGCTGTACTCGCGTGACGGAAAGAACGCGTTCCGGGCGCAG
TCGGAGATCAAGAACATCGTGACTGGCCACCCGCCTTCGCGCATGGCAACAGTGCCGGTCGACCCGTTTTTCCACCAGTT
CCTCCGCAACGACGTGCGGCCGCGGCTGCAGCAGGAACACGGCGTGTTTTTGGTTGTGCCGGACGCGTCTGAGCCGGCTG
CACCGTTGCTGCTGGTGTACGAGGGACCGTCGGGTGGTTCTGCCGAGCCGTACGCAGTTCCGCAAACGGCGCCGAGTGCC
GAGCAGCTGGCACTCTTCCAGCAGGGCGTACGCGATGCGCAGAAGCACATCCTGGACCTTATCGGGGCACAGGAGGACAT
CCAGGCGGTGTCAATCGACGTGCCGCTGAAGTATCACGACCGGCTCCGGCGGTTCATCAAGCAGCAGCAGGAGAAGCGGC
AGGCCAACCAGCCGCCTGTGCGGGTGTCCAACCTCGGCTCGGTGGTGACGCTGCGCGGTCCCAAGACGGCTGTCGAGGGC
CTCGCGGCGAAGGTGAACGCGTTTGTGGAGCAGGAGAAGGAGGACGAGAAGGAGCGCGGATTCACGCTGTCGTTCGACTT
CCCCAAGGCATACGCCAACCACCTGATCGGCAAGGGCGGCAGCAACATTCGCGACCTCCGCGACAAGTACGACGTGGAAA
TCCAGGTGCAGGACGGCAAGGTGGAGCTGAAGGGGCCCAAGGCCAAGGCGGAAGCAGCCAAGGCGCACATCAACGCGGTT
GCGCGGCAGCTGGCGGACGAGGTGACGCATGTGCTCAAGATCGAGCCCAAGTTTCACCGGGAGCTGATCGGGGCGCAGGG
CAGCACGATCAACCGGCTGCAGACGCGGTACAAGGTTCTGATCTTCTTCCCGCGGGTGGCCAAGAGCACGCGCGACGATG
ACTCGGCAACGGACGTGGCGAGCGAAGCGGGCAAGGGCCGGCGACAGCAGGGACCGGACGAGGTGATTGTGCGTGGCCCG
AAGCGAGGAGCGGACGAGGCGCGCGAGGAGCTGATGACGCTGTTCCTGTACCTGAAGGACAACGCGTACACGGCGACGCT
GAGTGTGCAGCAGAAGCAGGTGCCGTACCTGATCGGACAGGGCGGATCGGCGATGGACGCGCTCCGGCAGCAGACGGGGG
CGAAGATCGACATACCGAACAGCCGCGGCGACCCGGAGTCCATTGTGGAGATCCAGATCAAGGGAACCAAGACGCAGGTA
GCAGCAGCCAAGAAATTTCTGGAGGAGAAGAAGGCGGTGCTGGACGACACGGTGACGAAGACGATCGAGGTGGAGAAGAA
GTACCACAAGGCGCTGATCGGCACAGGGGGGTAATTTGTTTATTTTGTTTACTTAGTTTCTTTGTCTACGACCGGATCTG
CTAACACCTTCAGGATCCAACCTCCGAGAACTGGTGGTAAAGGCCGGCGGATCGGACGATCGACGGGAGCTGTCGCGCAC
GATCCAATTCCCGAGTCAGGACAGCAGCGGCAGCACGATCAAGGTGGAGGGCCGCAAGGCGGTGGTGGACGCGATCGTGG
CGCAGATCGAGGCATTTGTCAACGAGCGAGCGAGCCAGATCTCGAGCGTGTTGGACGTGCCACGGGACAAGCATCGGGCG
TTGATCGGACGAGGCGGCGAGACCCGACGACAGATGGAGGCCAAGTTTTCGGTGACGGTGGACATTCCGCGCCAGGGTGA
AGACCGGACGGAGATCAAGGTGACGGGGCTGCCGGCGAACGTGGAGAAGGCCAAGGAGCACATTCAGTCACTGGTGCGCG
AACAGCACAGCGTGACGGTACAGGTGCCAAGGCGGGTGCACCATGCCGTCTCGAACAACGGGCAGTTCTTCCGGCGGATG
CGCAACGAGAATCAGGTGACGGTCGACCATGCGGGCCAAGCGATTCCGCCACGGCCGACGGGGCCGACGGCAGCGATGCC
AGTCAACGGCAGCGGGACGGTGCCGCTGATCACCGATGACGAGGAGGCAGCAGCTGGTGCGCATTCGTGGCGCGTGGTGG
AGGCGACGTCGTCGGAGGAGGGCGATATTCCATGGGTCCTGCACGGCTCGCCCGAGAACGTGGAAGAGGCTCAGCGGGCA
CTGGCCAAGGCGATCGAGCAGCAGGGCCAAGGCGGCGGAGCGACAGGCTATCTGCTGCTGCCGGACCCGTCGGTGTTTCG
GCATATTGTCGGACACGGCGGCAAGAAGATCGAGTCGATCCGCAAGCAGAGCGGATGTCGGATTCACGTGCCGCAGGGCC
GGGCTGGCAACGAGCCGATTGAGGTTGTGGGCAGCAAGGAGGGCGTGGAGGTGGCCAAGGACCTGATCTTGGCGGCGGTG
ACGGAGGGCGCAAAGAAGCCAGAGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62