GenePrediction:GLEAN_4715 Details

Name: GLEAN_4715
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:849492..847528 (- strand)
Length: 1965
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:849492..849483 (- strand)
Length: 10
Type: CDS
Source: GLEAN
Position: GCSC_167:849317..849269 (- strand)
Length: 49
Type: CDS
Source: GLEAN
Position: GCSC_167:849171..848055 (- strand)
Length: 1117
Type: CDS
Source: GLEAN
Position: GCSC_167:847986..847528 (- strand)
Length: 459
>GLEAN_4715 class=GenePrediction position=GCSC_167:849492..847528 (- strand)
ATGGCTATGAGTACGTTGATGCCCTTGTCATTTCCGTGCCGACGCAATGGAAAACTAACAGAGGTTCCTGACAGATCTCG
ATTTGTCAAACGGTATGCAGAGCTATGGCTCTCCGCCCAGCTGACGGCATCCAGTCCTCCCCGACGACCGACATGCTAAC
AGTGTGCGTCATCAGCGGCGGTGATGAAGGATGAGCAGGGAAGGCCGTTCATCATTGTCAGAGAGTACGTCCGGATCTTG
CACATCTCTTTCTGTCCTGTGTGATAGAAGCAATCCGGGGGGACCACCTTTGCTAACCAGTCTCTTCTTCTTTCGCTGCA
GTCAGGGAAAGAAGCAGCGGCAATATGGCAACGAGGCGGTCAAATCACACATCCTGGCGGCGCGGACAGTGGCCAACATT
GTCAAGACGTCTCTCGGACCGCGCGGCCTCGACAAGATTCTCATCTCGCCGGACGGTGACATCACGGTAACCAACGACGG
CGCGACGATCCTGCAGCAGATGGAAATCTCGAACCACGTGGCCAAGCTGCTGGTGGAGCTGTCCAAGTCGCAGGACGACG
AGATCGGCGACGGCACGACGGGCGTGGTGGTGCTGGCGGGAGCGCTTCTGGAGCAGGCGGCAGAGCTGATCGACAAGGGC
ATCCACCCGATCCGCATCGCGGACGGCTACGACCAGGCATGCGACATTGCGGTGGCGGAGCTGGACAAGATTGCCGACGT
GCTGCCGTTTGGGCCGGACGACGTGGCCAACCTGACCAAGGTAGCACGCACGAGTCTGGGCAGCAAGATCGTGTCCAAGG
CACACGACCAATTTGCCAAGATCGCCGTGGACGCAGTCATGTCGGTAGCCGACCTGGAGCGACGCGATGTAGACTTTGAG
CTGATCAAGGTCGACGGCAAGGTCGGCGGCGCGCTCGAGGACTCGCTCCTGGTCAAGGGCGTCATCATCGACAAGGACTT
TTCGCACCCGCAGATGCCGTCCGAGGTGCGCGACGCCAAAATTGCCATCCTGACGTGCGCGTTCGAGCCGCCCAAGCCCA
AGACTAAGCACAAGCTCGACATCACCACTGTCGAGGAGTTCCGCAAGCTGCAGAACTACGAGCACGAGAAGTTTGTCGAG
ATGATCCAGCAGATCAAGGACACGGGCGCCAACCTGGCCATCTGCCAGTGGGGCTTCGACGACGAGGCCAACCACCTGCT
GCTGCAGAACAAGCTGCCAGCCGTGCGCTGGGTCGGCGGGCCGGAGATCGAGCTGATTGCCATTGCCACCAATGGCCGCA
TCGTGCCGCGCTTCGAGGACCTGACGGCCGCGAAGCTGGGCAGTGCTGGCATCGTCCGCGAGATGACCTTTGGCACCACG
CGCGAGAAGATGCTCGTCATCGAGGAGTGCGCCAACACCCGTGCCGTCACGGTTTTTGTGCGCGGCAGCAACAAGATGGT
GAGTTTGTATGGCTTGGTTTGGTTGTGGTTGATGTTCTTATGTAATCATATGTGCTGACAAAGCAGATCATCGACGAGGC
AAAGCGGTCGCTGCACGACGCCCTGTGCGTGGTGCGCAACCTGGTGCGCGACAACCGGGTGGTGTACGGCGGCGGCTCGG
CCGAGATTGCGTGCTCGCTGGCGGTGGAGGACGCGGCCGTGCAGACGCCAGGGCTGGAGCAGTACGCCATGCGAGCGTTT
GCCGAGGCGCTGGACACGATTCCGATGACGCTAGCAGAGAACTCAGGCCTCAACCCGATCGCAACGCTAGCCGAGGTCAA
GAGCCAGCAGGTCAAGCAGCCCGGCGGCCGCGGCCGGCTGGGTGTCGACTGCATGGGCCGGGGATCCAACGACATGAAGG
AGGCCTTTGTCATCGACCCGCTCATCGGCAAACGGCAGCAGCTGATGCTGGCCACCCAGCTGTGCCGCATGGTGCTCAAG
GTGAACAATGTCATCATCAGCGGGACCGGCGAGGATGCCTACTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62