GenePrediction:GLEAN_4717 Details

Name: GLEAN_4717
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:814881..808441 (- strand)
Length: 6441
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:814881..812818 (- strand)
Length: 2064
Type: CDS
Source: GLEAN
Position: GCSC_167:812757..812708 (- strand)
Length: 50
Type: CDS
Source: GLEAN
Position: GCSC_167:812364..812277 (- strand)
Length: 88
Type: CDS
Source: GLEAN
Position: GCSC_167:812227..809664 (- strand)
Length: 2564
Type: CDS
Source: GLEAN
Position: GCSC_167:809464..808441 (- strand)
Length: 1024
>GLEAN_4717 class=GenePrediction position=GCSC_167:814881..808441 (- strand)
ATGACACGCGAGTATTCTACGGGCAGACTGCCGCTGCAGCCGGTGCAAAAGCCGCCGTTCACGATCGAGTCCCCCGGCGC
AGTGGCAGTGCCGGGCGAGACGATTCCGCGGCGGAACCCCCAGGCACGAGATGGGCTGCTGGAGCAGCCGGTGCCAGGCG
TAAACACGATGTTTGCGCTCCTGCAGCGCAGCGCGCAACTGCACGCAGATGAACCGGCTGTGGGCAGCCGCAAGTTTGTG
GGCATCCGCAAGGAGACGAAGAAGGTGTCCAAGGTGGTGGACGGCGAGGTGCGGCAGGTGGACAAAGAGTGGTCGTTCTT
TGAGCTGTCCAACTACAGCTATCAGACGTATGCGGAGTACCTGTTGCTGGTGCAGCAGGTCGGATCCGGGCTGCGTCGTC
TGGGGCTGGCCAAGCAGGACAAGGTGCACATCTTTGCGGCGACGAGCCCGGAGTGGCTGGCGGTGGCCCAGGGCTGCTCG
TCGCAGTCGCTGGTGATCGTCACGGCGTACGACACGCTGGGCGAGGCCGGGGTGCAGCACTCGCTCAACCAGACCGGAGC
GGTGGCGATGTTTGTGGACCCGCACCTGCTGAAGACGGCGACGCGGCCGCTGGAGTCGGTGTCGACGCTACGATATGTGA
TCTACAACAACGCGACACACCAACCGGTGCCGGACGAGCAGCTGGAGGCATTCCGTACGGCACACCCGCACCTGCAGGTA
CTGAGCTTCGAGGAGCTGCGGGCGCTAGGCGAGGGCGAAAACGGACAGGCAGCCCTGGCGGCGGACCCGCCACAACCAGA
GGACACATTCTGCATCATGTACACGTCGGGCAGCACAGGGGTGCCTAAGGGGGTGCCGGTGACGCACGCGGGCTTTGTGG
CGGCCGTGGCCGGGCTGTACTCGGTGGTGGGCGACAGCGTGACGCACAGCGACCGGGTGTTGGCATATCTGCCGCTGGCA
CATATCTTCGAGATGGTGGTGGAGAGCCTGGTGCTGTTGATCGGCGGCACAATCGGCTACGGGTCACCACGCACGCTGAC
GGACGGATCGATGGTGCCGGGCTGTGCGGGCGACCTGCGGGCCTTCCAGCCGACAATTCTGGTGGGTGTGCCGCAGGTGT
GGGAGACGGTGCGCAAGGGGGTGGTGAGCGGCGTGGACTCGGCGGGCATTGTGGCCAAGGCGGTCTTCTGGGGCTACGTG
TGGCTCAAGGGCGTGCTGGCGCGAGCGGGCCTGATCGTGGGCCCGGTCGAGCAGGCGGTGGCGTGGCTGGACGGCATCGT
CTTCAAACGGGTGCGGCACAGCACGGGCGGGCGGCTGCGGTTCATCGTCAACGGGGCCAGCGCGATCGCGGGGACGACGT
TGAGCTTCCTGTCACTGGTGGTGGCGCCGATGATCACAGGGTACGGGCTGACAGAGACGTGCGGCAACGGGGCGCTGGGG
TCGCCGCTGCAGTGGACGCCACGGTCGGAGGGCCCAGTGTCGGGAGCGCTGGAGGTGAAGCTGGTCAGCCGGCCGGAGCT
GGGCTACGAGGCGAATCCGGCCACCGGCAGCGGACAGGACGCACACGGCGAGATTCTGGTGCGCGGCAAGCCGGTGCTCA
AGGAGTACTACAAGAACCCGGAGGAGACGGCCGAGGTCATCACGGCGGACGGCTGGTTCCGCACGGGTGACATTGGAGCG
TTTGACCGCAAGACCGGACATCTGCGGGTGGTTGATCGAGTGAAGAACCTGGTCAAGATGCAGGGCGGCGAGTACATTGC
GCTGGAGCGGCTCGAGGCCGTCTATCGCGGCGCAGCTGCGGCCCAGAACGTCATGGTGTACGGCGACGCGGCTCACGCGC
GGCCGATTGCCATCGTGCTCGTCAGCGAGAAGGCCATCGAGGACATGGCGGCACAGCTGGGCATCGTCGTGCCGGCTGGC
AACCACGCGAGCCTGCACCACGACAAGCGCATCCGGGCGCAGGTGCTGAAGGAGCTGGTGGGCGCCGGCCGGGCGGCTGG
GCTCAGTGCGATGGAGCTGGTGCAGGGTGTCGTGATTGCCGACGAGGAGTGGACGCCGGCCAGTGTGAGTTTGCGGGCAG
AGACGTCTTTGGATGGCTAGATCGTGTGACTAACAGAGAAACAGGGCCTGGTCACGGCGACACAGAAGCTCAACCGGCGG
CAGATCAAGGAACGGTACCAGAAGGAGATGGAGGAGTGTTTCAAAGGGATATAGGAGGTTGTGGGTGGTGTAATTGAGTT
GGGAGTGAGGAGTTGGGAAATGCAAAGTGTGAGTTCCGAGAATAGTGAGAGCAGAGTAGCAGTACTCCTTAGTCAGCAGT
CCAAAGTTCTGTAAAGGACGACAAGAACACAATCGCAAATGAATGCAGCAGGCAGCAGGCACTACTCCATATACTCTGTA
ATCTGTATGCACTAAGCCCCGGGGCTAAGACGGCTGGGTCACACGCCTGCCAACTCTGGCCATCCATCTCTCTTCGCCCC
GCCTTTCTGCGCCTCTCCCAATTTCGACCTGCACGAGCGACGAGCGTCTCCTGGAGCAGTTGCACGGTCTCGACGGGCCT
TCCGCCGATGCGCGCGTCCGCTCTCAACACCACCACGATTTCCGCGTGTCTCGACATGATCCGATCCTGACAGCCCGCTG
GTCCCTCCGCGAAGAGCGTCTCGAACAAGGCAATGGGACCGACACCCGGCTCCTCGTCCGCCTCGACGACAATTGTCCGT
CCAAGTCCGGACGGCGGCAGCCTTTCCAACAGCAGCAGCAGTCGAAGCCGCAGCACGAGCATGAGCACGGGTGCCGTCAA
CGGCTTCAGTCTGGGCGTGGCGGGCCCGCTGGTTGGCGGACCGGCCGCGTCTCCGCCTGGCAGCAGCAACGGCAGCAGCA
AGCCGTTTGCCCACTTTGACGACATCAACAACGTGCCGCTGGACGTCAACGCCGACATGCCCGTGGAAAGCCTCCTGGCC
CACACCGAGGCCGGCCTGAAGCAGGCCCAGTTCGCCAAGAGCATCGGCTGCCTGGACGTGGCCCTGCAGAACTACATCAA
GGCCTCAGTCATCCTGCTCCAGATCCTGCCGCATAATTCGGCCCTCCGATCCGTCATGGAGGCCCGCAAGGGCGCTCGAA
TGCAGTACAAAGCCCTGTGTGACCAGATCAGCGCCGAGAGCGACGCCTACGAAAAGATCAAGGCCCTCATCCTGGCCGAC
AATGCCCGGTCTGGCGTCGTCCCCAAGACGGCCCTCCCGGCATCCCGAGTCCAAGAGACCAGCCAGCAGGCCAGCCAGCA
CGTTCGCGCCAGGAGCACGGCCGTCCACAACAACGCGGCCGGCCACTGGCCCGACGTGCCGCCCAACCACCCGGTCAGGT
CCAAGCCGGCCATCCAGCCCAAGCCGCAGTCGCTCGCCGGCAAGACCATCAAACCGGCCGGCAGCCCTTCCAACAGCAGC
AACAGCAACAGCAACAGCAAACCGAGCTTAGACCTGGCCGAGCGGTTCGCCAAGCTGAGAACCGCAAAGGAACCCACGGC
AGCCGTCCAGACGAGCGAACCCAAGCAGGATCCCCGGATTCGCACACAACCCATTAGCCACACCGGCTTCCAGCAACAAG
CACAATCACAATCTTCACAGCAGCAGCAACAACAACAACAACAACAACAGCAACAACAACAACAACAACAGACACAACAA
CAGCAGCAGCAACAGCAGCAACAACACCCTACGCCCAGCATGCAGTTCAAGGCGTTCCGCTTCGACCCCCAACAGACACC
GGCGTCTGGATCGGCCCGGCCGCAGTACCCGGCTCTCATTGCCCCGTTGCCCGACCTCCCCAAAGTGCCCGAAGCGATCT
ACAGCCCGGCACGAGGGTCCGTTTCCAGCCAGGCAGCACAGCCTCCGTCTAGCACGCCCAAGGGCATGTTCAGTCGGACA
AATTCGACAACCTCGTTTACGGGCATGATCAAGACACCAGCTTCACAGCCGTCCTCCGAAGACTACTTCTCGCTGCGGCT
CTCCTCGGATCGAGCACCGCCTCGGCCCTACCAAGACCCAGCGCCGCCCCGAAGGCCGCGCATCTCGATTCCCGACGGCG
ACACCATCACGGTCCAGGAGCTGCTCCGGTTCATCAAGGCGGGGTCTAAGGAGATCCGCCTTCTCCTGATCGACATCCGG
AGCCGGGAAGAGTTTGATGAAGGGCACATCATGTCACAGGCGACCATCTGCGTCGACGTGGACACGCTGCAGCGGGAGAA
CATTGCGGCCGACGCCATCTCGGACAGCCTGGTCCTGGCACCGACGACGGAGAAGCGGCTGTTCGACAGCCGCCACGACT
TTGACCTGGTCGTGTACTATGACCAAGACACGAAGGCCATGCGGCTGATGGGTGACGGTCTCACGGCTGCCGAGAAGGCC
GTGGTGGCGCTGTATAACGCGCTGGCGTACTATGACTTTGCGCATGCCGACGGGGAGCACAACAAGAAGCCGAAGCTGCT
GCGGGGCGGCCTGGACGAGTGGACGGACATGATGGGCGCGGCATCGCTGCAGACGTCGTCGACGATGGCCGGTGTGACGC
AACGGTCGCGGCTGAACGTGCTCACGCGGCCACACGCCAAGTACATGGCCAAGCCGATCCAGGACGCGGCCGAGGCGAAG
CGATGGGAGGAGACCCTGAACAACATGGAGAAGCTGACGATCCGGCGGACGACGGAGGACTTTCTGCGCCGGTATCCGTC
CGTGTCGGCGATGCAGGAGTCGATGACGTCGATGACGACCGACAAGGCCGACAAGGCCGAAAAAGCCGAGAAGGCTGTCA
CTTCTTCGCGGAACAGCTCGCGGTCTTCGTCGACAGCACCCGGCCTCTACGCGACGCCGCCTCCACTACCGCCACTGCCG
ACACCACCGGCACGGCCGGCACCCACGGTGCCGCGGCAGAGCCACAGCGAGCTGGCCGAGGCCGACGACGAGGACCACTA
CATGCGCACGAAGCTGGCCAAGGCGGGTGTCGGCGGCGGCGGGCGGCTGCGGCGGCAAAAAGTCGGCCTGTTCAACCCCG
GCAACTGGTGCTACGGAAACAGCTCGTTCCAGTCGCTCTTCGCCTCCGGTGGCTTCTCCGAGGAGCTGACCACGGGCGAG
TGGGTCGACCGCTGGAAGGTGCCGATGAAGAGCGACGAGAAGATCAGCCACCCGCAGCTGCTGGCCAAGATCCTGGCCAA
CTCCTTCCACTGGATGCAGTACGGCAAGTTTGAGGCCATGAAGGCGAAGACATTGATGGTGGGTTTTTTTCTTTTTCTTT
TTCTTTCTCTTTTTTCTTTCCTTTTCTTTTCTTTATTGTCCTTCTTTCGTGTTCTTTTTCCCCTCCCTAACATCCCAGGA
CTACTGCTACCACATCCACTCCCACGACTTTGACGGAAGCACCAAATCGGACCGCAGCACCATTTTTGGCGGCCCGTATC
AACAAGACGCCCAGGAATTCATCTCGTTTCTGCTGACTAATCTGCACGACGAGACGAACCGGCTGCGAGACCGGACGGGC
GAGGTGCAGCAGCCAGCGCTGGACGCGCGCAGCACGGCACTGAGCAACGGACTGCGGTACTGGAACGAATACCGACGCTA
CAACGACAGTCTGGTAGACAAGTACTGGCGCGGCGTCGAGGTGACGGACCGGCGATGCCGCAGCTGCGGCCACCCATCGC
TGACGTACGAGCCGTTTGACGCGCTGCACCTGCCGATTCCGCCGACGAGCAGCGGCGCCGCCGTGACGACCATGTCCGAA
CTGTTGGCACAGTACTGCAGCGCCGATGTCTTGGCCGAGTACAAGTGCGACGCGTGCCGGCGAGCTGACACGACCGAAAA
GCGCGTGCGCCTGGTGCGGCTGCCCGATCTCTTGTGCGTCTCCTTCCGCCGCTTCCAGGGCAACGAGCACAGCGGCTTTC
GCAAGAACACCACCGCCGTCGTCTTTCCCATCGACGGGCTCGACATGACCCCATACACGGTGCAGGGCCAGACCGCGCCC
CCAGACATCGCCGCCGATCTCCGGGGCGTCAACGGAGACCGTCCGACAGAGCCGCAGTTCTGGGCTCCCTTCCTCTACGA
CTGCTATGCCGTCATCGTGCACAGCGGAACGCTGCGGTCAGGCCACTACCGGGCCTTTGTGCGCGACGAAGGCGGCGCTG
CTGCGGCCAGTCCGGCCATCAACGGCAGTGGCAGCAGCAACAGCAACAGCAACAACAACAGTGGAGCTAGCATTGGCATT
AGCAGCAGCAGCAACAGCAGCAGCAGCAACAACAACAGCAGCTCCACCATCGCCGACAGCCACCGGTGGCACCATTTTGA
TGATGCTCGCGTCGAGGCCGTCACCATTGGCAGCGGCGACGGCCGCGATATGGCCCGGCGGCTGTACCGCGACAGCGATG
TGGCGAGTGCGTACGTGGTCTTTTACAAGCGACGCCAGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62