GenePrediction:GLEAN_4718 Details

Name: GLEAN_4718
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:806029..804104 (- strand)
Length: 1926
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:806029..805883 (- strand)
Length: 147
Type: CDS
Source: GLEAN
Position: GCSC_167:805746..804979 (- strand)
Length: 768
Type: CDS
Source: GLEAN
Position: GCSC_167:804904..804104 (- strand)
Length: 801
>GLEAN_4718 class=GenePrediction position=GCSC_167:806029..804104 (- strand)
ATGGCAACGCGCAAGGTCCGCTACAAAAAACTCAGCATAAAAACAGCTCTACCTGTTTTACGTGAGGATCAGGTCGACCC
CAGCGAATACGAAGCCCTCACAAGCGAAACACAAATCGCAACCGGTGTCGACCAAGCAGAAGAAAATGTGAGTAAATTGA
ATTGATGAAAAGTCATTACCCTTTGTTTTGTTGATGAAGCATCACTCGTCACGTGCATTTGCACGTGATATTTCTTTGTG
TTACATAAGCGTTTCTGCGACCTAATGACTGACCTTTTCCTAGGAATACCATCTGCAGGTTGTGTTGCAGGGCCCGGCAG
CTGCCTCCGATAAGGATATTCCAGTGCCGCCGCCCCAGGAGAGCGACGTCAACTATGACGCCCTCTACTCTCGTAGCTTC
ACGCAGCCGGCAAACTATATACGCTTCTCGCAGACTGTCGAGGAGTGCATAGGATGCCTGTATGACATGACAGAAGAGGA
TGAGGAGTTTGTGAAATCATACAACCAAAAACGACCTGCGAACTCACAGTTGTCCGAGGATGACTTTGAGCAGATCATGG
AGGTTTTCGAGGACACTGCATCCATTTCAACCCCATATGCGTCAGTTGACAAGACGATTGTGCCATATGACCACATGGTT
GCCGGCCTGAACGAGCTTCAGTTGCCGAAAGTCATGCATCATGCGAAAGAGATCTATGAATACTGGAAGTCCCAGAGAGC
GGCAGTAGGTGGGCCGTTGCATCCAGCTCTCAAGTTCGAGACGCACCAGGACTCGGATGAAATGGACCCATTTGTCTGTT
TCCGGAGACGCGAGGTTCGGCAGACACGCAAGACCAGAGCACGGGACATCCAAAGCGCAGACAAGCTCAAGCGGTTACGT
CGTGAGCTAGAGGACGGACGACAGCTTGTCATCCTAGCACACGAGCGAGAGGTCCACAAGCGCGAGCTGCTCCGAGTTGA
CCGGGCCGTATATGAGCAGAGGGCCAAATTGAAGGAGATGAAAATCCGGCTTGGCATCAAGACGGATGATGAAGATCTCG
TCAACCAAAAGGTAAGCAGGAACCTGCGGAAGCTTTGTCCGAAAGGTGGCACAGGAGGCGCTGACATTCGCTTTCACCTT
GGCAGCCCCAGAAGAAGAAGGTGCCGGAGCTCTCTATTGCACAGCGTGCGCCGGGTGCCCAGGTGCGGGCGCCAGTGCGT
AGCGACGGACGGCCAACGGAGATGGACTTGGTGCAGCTGCTCGATGCTCTTGTAGAGAAGGAGAACGAGCTGCGTGCGGA
TGTGATCAAGAGGATCGAGAACCACCGGCGGTGGAACGAGAATCACGTCGACCTTACCTGCGAGCCATTGGGCCCGGTAA
AGGACCAGAATGTTGGCGCTGGATTCCGGCCAGTAAAGACGCAGTATTTGATGACGCCGCCGGCTTCCGAGACGTCCAAC
GACGATGGCACAGAAGCAATGGAGCTGGACGAGCCGGCGGCGCCGGTTGTATTCCAGTTCAGAGGCGTACAGCAGGAGGC
AGATGCGGCCGGCCCCCGTCTTCAGTTCCGTCGCCGGATAGGACGGCTGAACCGGTTGTGGATTGACCGCAAGAGAATGC
CTACTCCGCCTCGAGATGTGTCTCCGTATGGGGAGGAGATGGATGTGAACATGGTGTCTGACCGATGGAAGTACGACGCG
GACGACAGCGACGACGAGCCAGAAGTGTACGAGATCGACCCGTACGACACCCGTGCCCTCAAGTTCCGTGCATCGCTTCC
GCTGCCGTTTCCATTCCAGGCGCGGCGACAAGAGCTTCCGGCAAATGCGGCAGGACGAGCAGGCAGCGCGTCACAACCAG
GGCGGCCAGCAGGCCAGGTGCGGCCTCCAGCTGCACAACCAACACCGGCCGCACACATCTCAGGCACAGCCAATGGGACG
TCGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62