GenePrediction:GLEAN_471 Details

Name: GLEAN_471
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:45061..48535 (+ strand)
Length: 3475
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:45061..45105 (+ strand)
Length: 45
Type: CDS
Source: GLEAN
Position: GCSC_97:45171..45326 (+ strand)
Length: 156
Type: CDS
Source: GLEAN
Position: GCSC_97:45464..45782 (+ strand)
Length: 319
Type: CDS
Source: GLEAN
Position: GCSC_97:45851..45874 (+ strand)
Length: 24
Type: CDS
Source: GLEAN
Position: GCSC_97:45932..46983 (+ strand)
Length: 1052
Type: CDS
Source: GLEAN
Position: GCSC_97:47065..47104 (+ strand)
Length: 40
Type: CDS
Source: GLEAN
Position: GCSC_97:47407..47663 (+ strand)
Length: 257
Type: CDS
Source: GLEAN
Position: GCSC_97:47727..48017 (+ strand)
Length: 291
Type: CDS
Source: GLEAN
Position: GCSC_97:48086..48535 (+ strand)
Length: 450
>GLEAN_471 class=GenePrediction position=GCSC_97:45061..48535 (+ strand)
ATGCCTGCTCTCCAGGCCAAGGGCCGAGACGATCTCGTCATGGCTGTGAGCATCTGGTCCCGTTTTCATATATCCACCGC
CCGCGCAGCTCATCTGACCCGGCTGGCCAGACAAACAATAGCAGCATCGTGTCGAAGAGAAGCGTAGAGCGCATCTACTA
TTCCGGCGAGCGCGAGTACTACCGTTACTTTGTCAAAAAGTACCAAAGGCGAGCTCCGCTCATAAACCGCGGGTATCACC
TTCGACTCCACTTGATTGATGTCATGGTCCGCAATTTCCTTTGCCGTCCGAGTTCCAAGGCCAAGGTGGTTGTCAGCCTG
GGATGTGGAAGGCAAGCAGCGACGCGCTCTCGTGCAGCTCTTCACACGGCTGACGATGTTGTAGTGATGTCCTCCCTTGG
CAGACCATGTTCCGCTATCCAGAGCACTGCGAGGGTGTCAAGTTTGTTGATATCGACTTTCCCGATGTCATAATTGCGAA
GAGGAACATTGTGAAGCAGTCCGTTGAGCTTCAGGAGCCTTTGACAAATCTGGAGTTTCTGGAACACCCTCGTGTTTTGC
TTAAAAGTGACCAGTATTTCCAGATCGCCTGTGATTTGCGTCAGTCGTCTGTCATTGGCAAAGATCTCTCGACGCTCGTC
GACACTGCCAGCTCTGAATTTCTGTTCGTGGCCGAGGTTTCCATCACCTATATGGAGTTTGCGTCCGCTGATGCAATTAT
CCGTGAGACCTCATTCCTGACTATTCAAATACTGGAAATGCGACGTGCATACTGACACACCCTTTGAAAGACTGGGCCAG
CACGATTGGAGACGGTAAGACAGCTGTGCCTATACCTGGATGATGACTGAGGTTTCTGACATATTAACTAGCTGAGTTCT
GTCTCCTCGAGCAGATCTTGCCAGGGGGGCCAGCCGTGCCGTTTGCACAGACGATGATGCAGCATTTTGATAGGTTGGGC
ACGTCTTTGAAATGCATTCACGACTATCCCACTATAGACTCACAGAAAAAGCGATTCCATTCCTTGGGCTGGCTGGAAAC
TCGGTGCTGGTCTCTGTGGCAAGCGTGGAAGGACCCCTATTTCCTATGCGCTGCCGACAGGTGCCAGCTAGACAAAGTGG
AAGTCTTTGACGAGTGGGAAGAGTTTGCCCACTTTGCAAGTCACTACTTCATTCTCCACGCAAGCAATTTGGCCCCGGAC
CGGAGTTCTGGCGATGAAGTCTCGGCCAAGAACACCGGAACACCTGTATCTGACGTCAGCCTAAGCTTTTCGCCAGTCGG
ACAGCACAAAAACACCGGACTGAGGCGATTTGGCGTGCCATTGATCGTCAAGGATGCTCTGGGAGATCCCTGTCTGGCCA
ATTTATTTGGCATTGGAACCGATTGTCGGCTTCCGTCATACGACGTCTACAGTGCTCGTGGCGAACAGACGACCATTGAG
GATGACCTACTTCGAGGAGGAGGGCCAACAGCCAGGACGTTCTCGACCCTCACAGATATTGGTGATGCCGGATATCTGCT
GACCGGCGGCCGTGCTTCTCCAGCCAGCCCTTTCAGAGACTCGTGGATCATAAAAAAGGACACATATCGGTGGCAAAAAT
CACATGATCTTCCGCTGCCATTGTTCAGACATGCAGTAACACGGCTTCATAACGCACAGCTGGCTCTTTTGGCTGGCGGA
AAGTCAAGTGCCTCTGCGCTTTTCCCTGGCTATCTTCTTTATCATCCTGCAAATGGGTGGACGGAGTGCAAAGTGGTCAG
CTCATTGCGGCCACCCGCACTTTTTGGGGCTGTTCTTTTCTGCTCGGGGAGAGTGCGCGAAAACAGCAGCGCATTTTACG
GTACTTTGGCTGGCGGCATGACGGCCGACAACATTGTCTACGATCAAGCTGTCAGATGGGTGATTGACGTGTCTCAGGTC
AAGGTATGTTTACAAACGCCTGGCAGAGCTCGGAGTGTCGCTCACAAGTTCAGGAACCGACCATTCGCTTCGAGTCCGCC
ACAGACATGTTGGCTGCGCATCTACTTTGCCGATTTGGGGCTGCGTGCGTGCAAGTTGATGGCTGGACCGTGCTTGTAGG
AGGCATCACTGACGGCGGGAGCGTGCTGGAGGGAAGCGAAATATTGCGATACTGCGCCAGTGAAGATGGCAAAGAAGATG
CCCAATACTTGGACTATTGCAAAAAGCTCGACCCACAAACTCCTCGGCCAGTTTTAGTGGGTGCATCGGTCATAGGCACT
GATGATGGAGAGGTTGCCATTGTCGGAGGCGGAATGACGTGTTTCTCGATGGGCTCCGTATGGTCAAAAGGCCTGTATAA
ATTCCACGTCTGTCCAAATGATATAGGCGCAGGAGCCTCTATGGACTACGTGAAGACTTCGTCCATTGTCAACGATAAGT
CGAGCATAGCTGCTGGACCAAAGGCGCAGACAAAGCCTACAGAGACCACACCCATTCCTCGTCTGAAATTGGAATCAAAG
GATCACTTCGCAAGCATACTCCAGGCCGGAAAGCCATTTGTATTTGAGGGTCTTAGCATCGGATCCTGTACGGCGAAATG
GGACACCGACTATCTGGCCAAGCATGTAGGCCCTGGTCGCAATGTGAGTTGATTGATTTCATGGCTCATAGTTTGCTGCT
CCAAGTCGCTCACAACTGGACCACAGGTTGTTGTTCACGAGGCATCAAGTCCGACCATGGACTTTGTGTCCAAGAATTTC
CGGTACACAACCCGGGAGTTTGGCGACTTCATCCGCGATGTGGGCATGGGCAAGCAGCTCTACCTTCGGGCCCTCTCAGC
CAACCAGCCTTCAGATGTGCCAGCACGACTGTATATGGACTATCCAAGCCTCTCGGACGACTTCGTTCTGCCCCCGGAGC
TGGAGTTCGCCCGCGAGAGAGTTCACAGCTCCGTGTTGCGCATCTCTGGCTCTGTCAATATGTGGCTGCATTACGATGTA
AGTCTGGTACTAGGCTAACCCATATATATGCAAATAATCGATCTAATGGCGAGTAATCTTTCTAGGTTCTCGCAAATGTA
TATTGCCAGGTGCAGGGGTCAAAGCGCTTTTATCTCTTCCCTCCTTCCGACGTGATGCAGCTCGGATTCGGACCCGGTGC
ATCCAGCTCCAGTATCGACGTGTTTTCATCTATAGCAACCGGATCGCTGACTGACTGTCACCCCTACGAGGCCATTGTTG
GCCCCGGCGATGTTTTATTTATTCCACAGCTGTGGCTGCACACTGCCAGCCCTCTGTCCACAAGCAGCGTTGCTGTGAAC
GTGTTCTTCCGCGACCTGGAAGCCGGCTACTCTCTGGGACGTGACGTGTATGCAAACAGAGACCTGGCGGCGTATGAGAA
AGCCCGACAAGACATATCCAAGATATCGAAAATGTTCAGGGGCCTCCCCCTCGAGACAAAAGAATTCTATGTTCGACGAA
TTGCGGACGAGTTGATGCGGAAAGTATTAGAATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62