GenePrediction:GLEAN_4721 Details

Name: GLEAN_4721
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:780081..778440 (- strand)
Length: 1642
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:780081..780052 (- strand)
Length: 30
Type: CDS
Source: GLEAN
Position: GCSC_167:779980..779794 (- strand)
Length: 187
Type: CDS
Source: GLEAN
Position: GCSC_167:779521..779473 (- strand)
Length: 49
Type: CDS
Source: GLEAN
Position: GCSC_167:779415..778440 (- strand)
Length: 976
>GLEAN_4721 class=GenePrediction position=GCSC_167:780081..778440 (- strand)
ATGTCTTTCGGAAAGCTGTACACATTTGAGGTTGGTTACTCGTGCTCAAAGACGAGATACTCTCGTGAAACCTCTGTTGA
GACTGACATGTCTCTCGTCAGGCCAACCCGCGGTCGACGGCCACTCTGGCCATCGCCAAGGCCAACAACCTCGACATCGA
GGTTGTCCTTACCAACCCGGCCAGCCCGACTCCCGAGTACCTGAAGCTGAACCCGCTCGGCAAGGTTCCTACCTTTGTTG
GCTCTGACGGCTTCGTCCTCACGGAGTCCATTGCTATTGCCATCTACGGTAAGATTCAAATAATGCGCCTCGGTGCATGA
GTGCACGAGAAAATTGTCGATGAGAAACGACTCCCCTCACCCTTCTTTTCCTGCTACAGTGGGCGGGAAAGATATTTGCA
TGATGAGCTAGACATTTTTAACAGTTATCCCTGGCTGAATTTCCTGTGTTGACTTATTCTAACTTCTGACCAATATCTTG
TCTATTTTTTCTTGTTATTTTTGGCTGTTGCAGCTCCCAAAGTTGAGGAATTAGTGCGCTAATTCAACTGTGCGCTACAG
TGGCATCCCAGAACGAGAAGACCACACTGCTGGGCAAGACCAAGCAAGAGTAAGTTGATTGCGGCATCTCAGAATTGGCA
TCGCTCGAGATTCTAACTGCTCGCAGCTATGCCTCCATCCTGAAGTGGGCATCATTCTTCAACACTGAGGCTCTGCCGAA
CCTTGGTGCTTGGTACAACCCTCTTCTGGGCAAGAAGCCCTACAACAAGAAGAGCGTTGATGATGCGTCCAAGGCGGCTC
TGAAGGCCTTCTCCGTTGTCGAGGAGCACCTTCTGCACAACACCTTCCTGGTGGGTGAGCGCATCACGCTGGCCGACCTG
TTCGCTGCCGGCATCACCCTGCGCGGCTTCCAGTTTCTCTTCGACAAGGAGTGGCAGGCACAGTACCCCAACGTCACTCG
TTGGTTCATGACCCTGTACAACACCCCCATCTTCTCGTCTGTGGCGTTCAAGATCGAGTTCCTCGAGAAGACCACCCTGG
TCAACCAGCCGCCCAAGAAGGCCGAGGCACCTAAGGCCGCGAAGGCTGCCCCCAAGGCTGCTCCTAAGGCTGCCGCCAAG
GAGGAGGAGGAGGAGGAGGAGGCGCAGGCACCGAAGGCCAAGCACCCGCTTGAGCTTCTGCCGCGTGCCACGTTCCCCCT
TGACGAGTGGAAGCGCCAGTACTCCAACCTTGACACTCCTCTCGCCGTGAAGTGGTTCTGGGAGAACGTCAACTTCACCG
AGTACTCCATCTGGAAGGTGGCCTACAAGTACAACGACGAGCTGACGCTGACGTTCATGTCCAACAACCTGATCGGTGGC
TTCAACAACCGTCTGGAGGGCTCGCGCAAGTATCTCTTCGGCTGTGCGTCGGTGTACGGCGAGAACAACGCTTCGGTCAT
CGAGGGCGCCTTTGTCATCCGCGGCGAAGACTACCTGCCAGTCTTCGATGTCGCTCCGGACTACGAGAGCTACGCGTTCA
CCAAGCTGGACCCCACCAACGCTGAGGACCGTGCGTACGTTGAGGCCCAGTGGTCGTGGGACAAGCCTGTCGTTGTTGAC
GGCAAGTCCTACGCTCACGCCGACGGCAAGGTCTTCAAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62