GenePrediction:GLEAN_4723 Details

Name: GLEAN_4723
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:770141..768289 (- strand)
Length: 1853
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:770141..769992 (- strand)
Length: 150
Type: CDS
Source: GLEAN
Position: GCSC_167:769924..769844 (- strand)
Length: 81
Type: CDS
Source: GLEAN
Position: GCSC_167:769743..769308 (- strand)
Length: 436
Type: CDS
Source: GLEAN
Position: GCSC_167:769240..768997 (- strand)
Length: 244
Type: CDS
Source: GLEAN
Position: GCSC_167:768935..768574 (- strand)
Length: 362
Type: CDS
Source: GLEAN
Position: GCSC_167:768512..768388 (- strand)
Length: 125
Type: CDS
Source: GLEAN
Position: GCSC_167:768327..768289 (- strand)
Length: 39
>GLEAN_4723 class=GenePrediction position=GCSC_167:770141..768289 (- strand)
ATGGCTACTGATAAGGACAAGGCTCTCGCCTTGAAGAACGAGGGCAACCAGGCCTTCCTGAAGCACAACTGGACTGTGGC
AATCGAAAAGTACTCCAACGCCATAGAGCTGGACGGCTCGCAGCCGACATACTACGCCAACAGAGCTCAGGTGGGCTGCT
CTCGTCGACGTGCTCTCTGACATATGGCTGACTATCCGGTTCTCTTATCGCCCATAGGCATATCTCAAGACAGAAGCTTT
CGGGTATGCCATTGCTGATGCTACAAAGGCCATTGAGCTCGACCCCAAGTTTGTCAAGGTACATTAGTTGCGGATCGTGT
CGGATCACGGCTGTGCGCCTCTTGTCTTGGGAGGATCGGCTGGCAGGGCTGATATGTTTTCCTCTTTCATTCATATAGGC
ATACTATCGCCGTGCGCTTGCGGCAGCAGCCATCATCCGGCCGAAAGATGCCCTGGTCGACTTTAAGATCTGCGTTCGCC
TGGACCCTGGAAACAGAGATGCCAAGATCAAGCTTGCCGACTGCCAGAAGATTGTGCGCCAGCTCAACTTCTTTGCCGCC
ATCGAGGTCGGCGACGAGCCGTCGGCGGCCGAGGGCCTTGATGTCGAGTCCATGGCCGTCGAGCCCGACTACGACGGCCT
GAAGCTCGGCGACCAAATGACCCAGGACTTCATCGACGACATGACCGAGCGTTTCAAGACCGGCAAGAAGATCCACCGCA
AATACGTCTACCAGATCCTGCTCGCCGTCACCAAGCTAGTTCACGACGAGCCAACCATGGTCGAAATCGAGGTGCCAGAA
GACACACAACTCACAGTTTGCGGCGACACCCATGGTTTGTGCCCTCTCTGCCATGATTACTCGTGGCACTCCACACCCGC
TAACACGCACCCTGTCCACAGGTCAGTACTTTGACCTCATGGAGCTGTTCAGGCTGAACGGCAAGCCGTCCGACAAGCAC
TGGTACCTGTTCAACGGTGACTTTGTCGACCGAGGATCCTGGTCTACCGAGATCGCACTGCTGCTGTACGCGAACAAGTG
GCTGCGGCCACAAGCCTTCTTCCTGAACCGGGGCAATCACGAGACCGACGACATGAACCGCGCGTACGGCTTCGAGGGCG
AATGCAAGGCCAAGTACAACGAACGGTGAGTTTTCAGCTATCCCTTGGGTGTGTGCTGCCATGAAGCTAAGCTGACTATC
GCCCAGTGTTTTCCGCCTCTTCTCCGAGAGCTTTTCGGCCTTGCCGCTGGCCACTCTAATTGGATCAAAGTACCTCGTCT
TGCACGGTGGCTTATTCTCTAACGACAACGTCACCCTGGACGACATCCGTAAGCTGGACCGGCATAAACAACGCCAGCCC
GGCCAGGCCGGCCTCATGATGGAGATGCTATGGACCGACCCGCAGACAGAGCCCGGTCGTGGCCCAAGCAAGAGAGGTGT
TGGCATGCAGTTCGGCCCAGACGTGACGGCCAGGTTCTGCGACAAGAACGGCCTGGAGGCCATCATTCGGAGCCACGAAG
TGCGCATGGACGGGTACGAGAAAGAACACAACGGAAAGTGTATCACTGGTAAGTCGCACCACTCTTGCAGCTGGCTGGCT
TCTTTCCCCTGCTGACCATCGTTTTCTAGTCTTCTCTGCACCCAAATACTGCGACATGACAGAAAACCGGGGCGCCTACA
TCAACCTGGGCTCCGATTACAAGCTCGAGTTCCACCAGTTTGATGCCGTTCCACACCCCAACATCCGCCCCATGGTAGGT
TGATCCGTTGTCTGCCCTTTGGCTTGAGCTCTCTCCCAACTAACATCCGCCCAGGCGTACGCCAACAATTCGATGATGTC
CTCCTTGGTATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62