GenePrediction:GLEAN_4724 Details

Name: GLEAN_4724
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:767088..766590 (- strand)
Length: 499
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:767088..767008 (- strand)
Length: 81
Type: CDS
Source: GLEAN
Position: GCSC_167:766951..766698 (- strand)
Length: 254
Type: CDS
Source: GLEAN
Position: GCSC_167:766620..766590 (- strand)
Length: 31
>GLEAN_4724 class=GenePrediction position=GCSC_167:767088..766590 (- strand)
ATGTCTGAAAACTACGTCGCCCCTGGCCAGCAGCGCTACCTGCGCGCCTGCATGGTCTGCTCGATCGTCATGACCTTCCA
GGTAGGTCCTCGAGGTTCCTTGAGACACACGAGAGCAAAGGGAGCTGACGAGTGCAGCGCTTCCGCGAAGAGGGCTGTCC
CAACTGCGAAGAGTTTTTGCACCTCGCCGGCTCGCCCGAACAGATCGACATCTGCACCAGCCAGGTCTTTGAAGGCCTCA
TCACGCTGGCGAACCCGAACAAGTCGTGGGTGGCACGCTGGCAGCGCCTCGACGGTTACGTGCGCGGCGTGTACGCGATC
AAGGTGTCTGGGCAGCTGCCGGACGACGTGCGGACGCAGCTGGAAGAGGAGCACCGGATCCAATACATACCGTGAGTCCT
GTTTCTTTCTTGGCCTGTCGGCCCTTGTTTGTGTTATCACGTTTCTGACAAAGCTCTCTCATTGCCAGGCGTGATGGAAG
CGCCACCGAGGCCGACTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62