GenePrediction:GLEAN_4725 Details

Name: GLEAN_4725
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:764691..761914 (- strand)
Length: 2778
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:764691..764682 (- strand)
Length: 10
Type: CDS
Source: GLEAN
Position: GCSC_167:764619..764496 (- strand)
Length: 124
Type: CDS
Source: GLEAN
Position: GCSC_167:764423..764235 (- strand)
Length: 189
Type: CDS
Source: GLEAN
Position: GCSC_167:764175..762066 (- strand)
Length: 2110
Type: CDS
Source: GLEAN
Position: GCSC_167:762000..761914 (- strand)
Length: 87
>GLEAN_4725 class=GenePrediction position=GCSC_167:764691..761914 (- strand)
ATGTCGTCCCGTAAGGACATCCCCTAGCTGGCAGCAAAGGCCTCAAGCTCTAACAGACATGGCGACGCGCAGTCAAGCAA
TTCATTCGGAACGTGCGAGCGGCGAAGACGATTGCGGATGAACGGGCAGTGATTCAGAAGGAAAGCGCTGCTATTCGGGC
TAGCTTTCGCGAAGAGAGCGCAGATCACAACGTCCGGTAGGCACGAGACAAGAAGGTCGCAGACGATGGATTGGCGTGCC
GAAGTGATGCTGACTGTGTGGTGTGCAGGCGGAACAATGTGGCGAAGCTGCTCTACCTCTTCACTCTCGGCGAGCGGACG
CACTTTGGACAGATCGAGTGCTTGAAGCTGCTGGCTTCACCGCATTTTGCAGACAAGCGGTTAGGCCACCTTGCGACTAG
CTTGCTGCTGGATGAAAACCAAGAGGTGCTCACGCTTGTTACAAACTCGCTGAAAAAGTATGGACTGGCCTCCCTGACAG
CGCAGGTCTCAGTCTGCCCGGCTAACGGATCTGCAGTGACCTGTCTCACTCGAACCAATACATTGTCGGCCTGGCGCTAT
GCACGCTCGGAAACATTGCGTCGGTGGAGATGTCGCGAGACCTGTTTGCGGAGATTGAGAACCTAGTGTCGACGTCGAAC
CCGTACATACGACGAAAGGCGGCGCTGTGTGCGATGCGAATATGCCGCAAGGTTCCCGACCTGCAGGAGCACTTTGTGGA
GAAGGCGACACACCTGCTCTCGGACCGGAACCACGGCGTGCTGCTCTGTGGGCTGACGCTTGTGACCAGCCTGTGCGAAG
CGGATGAGGAGGAAGGCGGGGAGGAGGGAATAGTCGAGCAGTTCCGACAGTTTGTGCCGTCTCTGGTGCGCACGCTCAAG
GGACTTGCGTCGTCTGGATATGCGCCGGAGCACGATGTGACGGGTATCACGGATCCGTTCTTGCAGGTCAAGCTGCTACG
GCTACTCCGTGTTCTTGCGCGTGGCGACTCGAGGACGAGCGAGATGATCAACGACATTCTGGCACAGGTGGCGACGAACA
CGGAGTCGTCGAAGAATGTAGGCAACTCGATTCTGTACGAGGCCGTGCGTACGATCCTGGACATTGAGGCGGACTCGGGG
CTGCGCGTACTGGGCGTGAACATCCTGGGCAAGTTCCTGTCAAACCGGGACAACAACATCCGGTATGTGGCCTTGAACAC
GCTGATTAAGGTGGTGGCCATCGAGCCGAATGCGGTGCAGCGACACCGGAACACGATCCTCGATTGCCTGCGCGACCCGG
ACATCAGCATTCGGCGGCGTGCGCTGGAGCTCAGCTTCACGCTGATCAACGAGAGCAACGTGCGGGTGCTGATCCGCGAA
CTGCTCGCGTTCCTGGAGAGCGCGGACAACGAGTTCAAGCCGAACATGACGAGCCAGATCGGGATTGCGGCGGACAAGTT
TGCGCCCAACAAGCGCTGGCACGTGGACACGATGCTGCGGGTGCTCTCGCTGGCGGGCAATTACGTCAAGGAGCCGATTC
TGTCGTCGTTTATTCGGCTGATCGCGACGACGCCGGATCTGCAGACGTATGCGGTGCAGAAGCTGTACGCGAACCTGAAG
AAGGATATCACGCAGGAAAGCCTGACGCAGGCGGCGTCGTGGTGCATTGGCGAGTACGGCGATGCGCTGCTGCGTGGTGG
CCAGTACGAGGAAGAGGAGCTGGTGCAGGTGGTGAAGGAGGAGGACGTGCTCGATTTGTTTTCGACCATCCTGAACAGCA
GCTATGGCACGCAGGTGACCAAGGAGTATATCATGACGGCTCTGATCAAGCTGACGACACGGCTGTCGGACGCGGCGCAG
ATCGAGCGAGCGCGACGAATGTTGCAGGCCAACGAGACGAACCTGGACGTGGAGGTGCAGCAGCGAGCCGTCGAGTACAC
CAACCTCTTCGCGTACGACCAAATACGGCGCGGCGTCCTGGAGAAGATGCCGCCGCCACAGATCCAAGAGTCGTCGCGGG
TGCTCGGCGAGGCGGCAGCGACGAAGAAGTCCAAGGCGGGAAATCGGCGGTCCAAGATTGTGAAGCCATCAGAACAGGAT
CTGCTGCTGGATCTGATGGGCGACACGGCTCCAGCAATTGTGGCACCGGTGAACGGTGGCGTCAACAATGCGGACCTGCT
TGCGGATATCCTCAGCGGCGGCTCTGCGACATCGACTGCGCCAGCAGCTGGCGGTCCGCCGTCCAACGTGTCTGCCATCC
TGGACCTCTTTGGCACGACATCACCGGCTGCATCGGCATCACCATATCCGGCTCCCACAGGCACGCCTGCCGGAACGATC
CCGGGCGACCTGTTCTCGGCTGCTGCGGCCCCTTCGCCGCCTATACAGCCACCGACAGCACCGGCAGGCTTTCCATGCTA
CAACGGCAACGGGCTCGACATCACGATCGCGACGCAGCGGAATGCCGAGGGCGCGGTGCAGGCGACAGCCCGGTTCCGAA
ATGTGGGCGGTGCAGCTGTTTCTGGCGTCGGTCTGCAGGCGGCCGTGCCCAAATCGCAGAAGCTGCAGCTCCTGGCCATC
TCGTCGTCCGACGTGGCACCAGGCCAAGAGGCCAGCCAGCTGATGCGGGTGATCGGCGCAAAGGGGGTACGTCTGTCCAA
AAGGCTTACATTTTTTATTTAGCGTGCTTTTGCTAACTGTCTTGTGATTAGCCTCTCCGTCTGCGGCTGCGGATTACGTA
CACACACCCATCGGCTGGCCAGGTCCTGGAGCAGATCAATTGGACAGAGCCGTCTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62