GenePrediction:GLEAN_4726 Details

Name: GLEAN_4726
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:756329..752671 (- strand)
Length: 3659
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:756329..756200 (- strand)
Length: 130
Type: CDS
Source: GLEAN
Position: GCSC_167:756125..752671 (- strand)
Length: 3455
>GLEAN_4726 class=GenePrediction position=GCSC_167:756329..752671 (- strand)
ATGGCCGAGAGCGATGACGGCCTCTCCCTAGAGCCAGGACCATTTGTGCTACGCTCTCTGCTCGACAACATTCCACTCTC
GGCCGACGGAACGGACGAGGACATCAAGATCAACTGCGTGGAATACTACGGTAAATCCCACCACCGTCCACCGCCATCTT
CCCCTGTGTCTAGGCCAGCACTGACCCGACTTCCTGCGGTAAAGATGGCAATCTCTATGTAGGCACGTCGGCCTCGGAGC
TCCTCCATTTTGTCCAGATCCCCCCCGATCCCAATGACGAGAAGTCGACGAGCGTCTTCATTCTGGCCTCACGGCTCAAG
CCACCCTTCTCCGAGTCTGCCAATTCTCCGTCCAGTCCACGGCCGGGCGTCCAGCAGATTGTCCTTCTCCCGCCCGTCGG
CAAAGCCTGCGTGCGCTGCAACTGGACCGTGACGTTCTACTCGCTGCCCGAGCTGACCCCCATCTTCCGCGAGGTCAAGA
ACTGCAACTGGATCGGCGGCGTCGACCTGACCGAGGAGGCCGCAACAAGTCATTCGCCGCGTGTCACCATTTTGCTCTCG
CTGAATCGCCGTCTCCAGGTCGTGCGCATCGGCGATGAGGCTCGCGCCATCAAGAACATCGACCTTGCCTCTAGCATACG
ATCTGCTCGCCACGATGCCATTGCCTGCGTGGCCGACACCAAGAGCTATACTCTTGTCCATGTGGAGCAGCAGGCCAAGA
TCCCGTTGACCAACATTTCCTCTTCTGACCAGACACCGCCGCCAGAGCCGGCTTCCCGAATCCTGGCCGGCGAAGCTGGC
GACGGTCTCGCGCGCAGCTCTTCAAACGCACAACCACAACGACGTCCCAGCTCTGCCGCTTCACCTGATTCCCACAACCG
CAGCACAAGTCTCGGCGGTACCGTCACCGGTAGCGCGCCGCAGCAGCAGGCGCCTAAAGAGTCTGATGCCAACACAGGAA
CCCATGATGTCGCAAAGCCAGCGGCAACATCGACGAGAAGCTCAGAAGAGACAGGGTCCGACGAAGCCGGCCGCATTCGG
CATACAGCGCACATTCCCCCAACTGCTCAAGGTACGGCACTATTGCGGCCCAAGCCTGGCCCATTAGAGCCTCTAATAGC
GGCCCCCACGCCAGAAGAGTTCCTCATTGTCACTGGCACCAGCCCTGTCGATCCCGGCATTGGAATGTTTGTCAACCTGG
ATGGCGACCCCACACGGCCGACACTCGAGTTTGCCAGGTACCCCAGCATGATCGTGGTAGACGGAGGCTCAGCCGACCCG
TCCTCTTTGCGCATGTCCCTCGGGGGTGCGGGCGGTTCAGGTGAAGATGAGGGGGACGGATATATCCTTGCAGCCATGTC
CAGAGACTTCCCAGACGGCCTACATCACGGCCTGGAGATCCAGCGTTGGGACGTGAACAATGGCGAGGATGAGCCTCCCA
GATCGTGGCTAGAGGTTCCGGGCAACGGCCCGGCCTTGCCGGTAGGGATCCATCCCCTCGTGAGTAGCCAGGAAAGCCTG
GTCCGTGAGGTGGTAGTGAAGCTGTGTCAGAAGCGCGTGTCCCTGCCCTGTCAGCCAAAGGACGGCCCGAACAGCCCAAA
GGTCAGCAGCAAGCCGGTTGCGGTGGAGGACGAAGAGGCCAGCCGCTACAAGTCCGAGGTGGTCTTTGCCAGCCGGCTTG
CCAAGACAAGCGGCCGAATTGCCGTCTGGTCCGGGAACCAAATATGGTGGGCAATGCGAAATCCACTGGTATTGCAGCTG
GAAGCAGCTCTGGCTGCAGACAGGCTTGGAGACAAAATAGCCCCAAGCACGGCTAAAGAGAGAGTGCAGCTCTTCACCGT
GCTCGGATCATTTCGAGGCCGGGAGGCCAAGACGGAGCTCGAGTTTGTGACATTCAGCTACATCCGGCAGAGGGCCGGCG
GGCTGCTCTTCATGGGTCTCCTCCAATCTGATGGATCGGCGCCTTTCTCGGACGGAGAGCTGAAGGCGATGGGCGAGGTT
CTGCTCGACAGCGGACTCGACCCGCGCATTATCGTGGCCATGATCCCAGGGCTCCGGGAGGAGATCGTGCAAAGCCGCAA
GGGAATCTGGATATTCGGGGGCGTGAAGGACATTGTAGAACGATACCTGAACAGCGACGAGGCCGGACGGGTGGGCAAGA
GCGTGGGCTCTCTGCAGTCGCCGATCCTGCACTTTCTTCGACGATTCCTGATCGCGTGGAGGCGAAAGAAGGGTTTTGGC
AGCGTCGCAGACGAGGGAGACGTGTTCCGCAGTGTCGACGCGGCCCTGCTGGCGGTGTTGCTGGAGCTGGACCAAGGCAG
CCCCAAGGGGCTCGTCACGGCCAAGACGGGCTCGGTGCGGGGGGACCTGAACGACCTGGTGGACAAGGGTGTGGACTGCT
TCGGACGGGCGGTAGAGCTTCTAGAGGCGAAACACCGACTGTTTGTACTGAGTCGTCTGTACCAGAGCCGCAAGCAGGCG
GCAGATGTGCTGGCAACTTGGAGGCGGATCGCAGAGGGCGAGCGAGACGACGGCGGCGAGCTGCAGGACGGCGAACAACG
AATCCGTGAGTACCTAGCCAAAGTGAGCAGCCAGACGCTGGTGCAGGAGTATGGCCTCTGGCTGGCGAAGCGTCGGCCGA
AGCTGGGAGTGCAGGTATTTGCCGACGACAAGGCGCGAGCGCCGCGATTCGAGCCAACACAGGTGGTGCCGCTGCTGCGC
AACGAGGCTCCGGGTGCGGTCAAGTACTACCTGGAGCATCTGGTGTTTGCCAAGGGCCAGGCGACGTATGTGGACGAGCT
GATTGCATACTACCTGGAAGTCGTCACGGGCGAGCTGCGGGGATCCGAGGAGGCACGCAGCACGATGCGGGCGGTGTATG
AGGCGTACCGAGCGCTGCAGCCGCCGAAGCCTACTTTCCACCGGTTTCTGCGGGACAACACGCTTCCGGATGACGAGGTA
GCTCAAAGCCGGCTGCGACTGCTAGAGCTACTGGGTAGTCCGTATCCGTTTGACGTGGGGGCGATTCGGCGACGGCTGGC
CGAGTCATTGCCGGCGGCGACGGCGACGACAGCTGCGGCCGAGCAGCTGCTAGTACCCGAGGCCATCATTCTGGACGGCC
GTGAGCACCGACACGAGGACGCACTGCGGCTGCTGGTGCATGGTCTGGGCGACTACGACACGGCGGTGTCGTACTGCGAG
CGAGGCGGGTCGAGTCTGTATGTGTCGGTGCGCGGGGCAGACACGGCAGAGCTGCCGATGCTGCCGCCGACACCGAGGCG
ACGCGAGAGCCTGCCGCCAACGCGCGAAGAGCAGGCCGGGCTCTTCCGAGCGCTGCTGGTGGAGTTTATGGCCATCGAGG
ACGTGAGTGACCGAGTTGAGCAGACAGGCGCGCTGCTGGGCCGGTTTGCCGGCTACTTTGACGTGCTGGACGTGCTGCAG
CTGCTGCCGGACTCGTGGGCTGTTGATGTGGCCGCTGGCTTCCTGGTGCACGCGCTGCGAGAGCTGGTGCGAGACCGCAA
TGAAAGTAGCGTGGCGAGAGCGCTGAGCGGAGCTGAGAACCTGCGGCTGCACGCCGAGCTGATTGCGCAGATCGACAAGA
AGGGGCCGCAGACGGAGGAGTTGTCGCTTGAGGGATCCCATATTGAAGCGGAGACATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62