GenePrediction:GLEAN_4727 Details

Name: GLEAN_4727
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:747820..746054 (- strand)
Length: 1767
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:747820..747384 (- strand)
Length: 437
Type: CDS
Source: GLEAN
Position: GCSC_167:747319..746748 (- strand)
Length: 572
Type: CDS
Source: GLEAN
Position: GCSC_167:746652..746054 (- strand)
Length: 599
>GLEAN_4727 class=GenePrediction position=GCSC_167:747820..746054 (- strand)
ATGTTCTGCTGCACTGTCTACCTGCATACTACGCCGGGCGGCCCTGTCAATGCGAGCTGTCCGCTTCCGTTCGTTTGCGT
CAGCGAGTCAGCCACACGATTACGATATCTCGACAACCCGTCCACCTCTACGACGAATCAGGCCTGCGACGACGCCCAGC
ACGCAATTCACGACGCCTCGAACACCGCCTTGCTCTGCCGCCCGTTGCGATTGCACCCTTGCGCCTCGCATTCCATCGGT
CATCTGCCTGTCAAGCGCGATTCGCCGTGGCGACGGAAAAGACAAAGAACGAGACGACTGCAAGCCCGAGACGCTTTCGA
AGCTCGCCCGCCGTGCGCTCCCGCCGTCCTCGTTCCGTCCGCCCGCACGAGGCAGGCTGCTGGAGGTAGCTGTGATCTTG
GCGTGGCGTCTGCCATGTGGCGAGACCGTACCAACCTGTGAGTATAAGTCAGTCAGTCTGTGAGTGAGCCGACGATGTCT
GACTGCCGACGATGCGAACAGCTACATCTCCTACCGCCAGTCCTACGCACACCACCCGAAGAAGCGGACGCGGTACTATG
GCGGGCTCACCGGCGACTCCGTGGGCGCGGCCGCCAGCAGCGCTCTCGACGAAGACCGGCGCGGCCTGCTCTCGGGTCCC
GATCCGTTCTACGACCATGCCGACGAGACGATTAACGCGGCCGGTGACGCCGTGATCGAGATGGACCTGCTCCCGCCGCG
CTGGGCTGATATCTCGGACGAGGTGACCGAGATCCTCGGCGACGTCGCCCGTCAGAGCCAACAGCTCGACCGGCTGCACC
AGAAACACGTGCTGCCCGGCTTCAACGAGGACGAGGCGGCCAAGCGGGCCGAGGAGGGCGAGATCGAACGTCTGACCCAG
GCCATCACGCGCGGCTTCCACGACTGCCACCGCTGCATCCAGCGCATCGACCAGATGGTGCGCGAGTCCAAGGGCCAGGG
CAGCCTGTCGCGGGCCGACGAGACCATGGCCAAGAACGTGCAGATCTCACTGGCCACGCGGATCCAGGAGGCCAGTGCCA
CCTTTCGCAAGAAGCAGAGCACGTATTTGAGGAGTAAGTGGGGAGAGCGGGAAAAAGTAGAGAATACAATGACGAAAGAG
AAAGAAAAAAAAAGAAGGAAAAAAAAAAGAAAGAAGCTGACCATCCAGAACTCAAAGGCGTCTCCGGAGGTCCCGCATTG
GCCATGGCCGGAATCAGCTCCAACTACGCTGCCGACCCGTCACTCCTCGAGTCCGACGCCGACCGGTCCTTCTCGCAGCT
AGCACTGCAGGAAGCCTCGTCTTCGCAGCCGCAGCAGCGCCAGCAGCAAATACAGAAAATGCAACGCCAGTCCAACGATG
CCGTCATCGCACAGCGCGAGCGTGAGATCGGCGACATCGCCCAGGGCATCATCGACCTGGCCGACCTGTTCCGGGACCTG
CAGACCATGGTCATCGACCAGGGCACGATGCTGGACCGCATCGACTACAACGTCGAGCGCATGAACACCGACGTCAAGGC
GGCCGACCGCGAGCTCGTCGTGGCCTCGGGCTACCAGCGCAAGACCACCAAGCGCAAGATCATGCTGCTGCTGCTGCTCA
TCATCGTCGGGCTCTTCATCCTGCTGCTGATCAAGCCAAAGCGGCATAGAGGCGGCGGCGGTGATGGTGGTGGCTCTGAA
GCTGCTAAACAAGTGCCTGGAAATGTCGACAGCGGCGGCGAAGAAGCAGAGCAAGACTCCCCTTTCCTAATGTCGTTCTT
GTCATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62