GenePrediction:GLEAN_4728 Details

Name: GLEAN_4728
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:742509..741973 (- strand)
Length: 537
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:742509..742505 (- strand)
Length: 5
Type: CDS
Source: GLEAN
Position: GCSC_167:742339..742255 (- strand)
Length: 85
Type: CDS
Source: GLEAN
Position: GCSC_167:742146..742086 (- strand)
Length: 61
Type: CDS
Source: GLEAN
Position: GCSC_167:742025..741973 (- strand)
Length: 53
>GLEAN_4728 class=GenePrediction position=GCSC_167:742509..741973 (- strand)
ATGGGGTGAGTCTCCCCCTTTTTCTGGCTTTGTCGGCGCCTCGCTCCAATGGCTGCTGGCCAATGCGACGTGACTCTGTC
AAAATTCTGCCCCTCGACGACAACGACGATGGCCATGGTGTCGGATCACAAAGTATGGATCGCTAACGCTCGTCCGCGTC
TCCCTTTTAGTCTCATCGACGCCCCCAACAAGGTTCCCTACTTCCAGCGCACCTACCAGGCTGCGTTCCGCGGACACACC
CGCCTCTGGAAGATTGTCAGTATTATGTCGCAACCAGTCCTTCGTTCACACTCGCGCGTTTCCGTTGATCCGGGTTATTC
CATACAAGCATCTAGGACTGTAGCTGACAATAGTCCGATACAGAACCCCCGCAGCAATGTGCTTCTGACGCCGTACATGG
TCATCCTCTTTGGCTCCGCTGCCGGTTAGTGCTCAAAGTCGCCCGATCATCGTAGCCTGGCTCCCATACTAACATCACGA
ACAGCTACCACATACGGCATGACCCGCAAGGTTCTTGGCTACAACACGTTCTGGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62