GenePrediction:GLEAN_4729 Details

Name: GLEAN_4729
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:738220..736019 (- strand)
Length: 2202
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:738220..738207 (- strand)
Length: 14
Type: CDS
Source: GLEAN
Position: GCSC_167:738096..737905 (- strand)
Length: 192
Type: CDS
Source: GLEAN
Position: GCSC_167:737843..737808 (- strand)
Length: 36
Type: CDS
Source: GLEAN
Position: GCSC_167:737739..737475 (- strand)
Length: 265
Type: CDS
Source: GLEAN
Position: GCSC_167:737418..737338 (- strand)
Length: 81
Type: CDS
Source: GLEAN
Position: GCSC_167:737284..736664 (- strand)
Length: 621
Type: CDS
Source: GLEAN
Position: GCSC_167:736600..736019 (- strand)
Length: 582
>GLEAN_4729 class=GenePrediction position=GCSC_167:738220..736019 (- strand)
ATGGATACTCTTCTGTACGTATTATAGGCCCCCTGTCTCTCAACCAGTCTGCTTCTCAGGCCGCTGCGCTATCGCGGCCG
CATGTGCGAGCTCGAGGGTGCTAACCACGAACCGATGTTGTCAGCACAGCCGAAATTGCGGCCAACGCGCCGCGGTACCG
TCGCAAGAGCTCGACATTCATTGACGGAATACACGATGTCTCTACCGAGCCGAACCACATGGCTCCGGCCCAGCTGTACA
GCACCATGTCTGGCCGGCTCTTTCATTCGGGTCGCATTGCCATCGTCATGGTTGGGCTGCCAGCACGAGGTAAAACGTGA
GTGAAGCTCTTTCAACACTCTTGTCTGTGCCTTACAATTGACTGACTCTCCCAACAGACACATCTGTGTCTCTCTGTCTC
GTTATTTGCAATGGTAAGACTTGTCCCCTTGGAGTGAAAGTCCTCCGACGTCCTACGGATAGCTCATGCTGGCATGGCTA
GGTTGGGCGTCAAAACGCGCATCTTCCACCTTGGCGATTACCGTCGTGCGACCATTCCGGGTGGCACGGTGCCAACAGAC
TATTTCTTCCCAAACGCCACCCCGGCATCAATCATGTTGCGCCAAAAGATCCTGAAGAGGTGCCGGGAAGATATCTACTC
CTGGCTCAACCATGCCAACGGCCAGGTAGCAATCTACGACGCCGTGAATCCCACGGCAGCTGGTCGACGAGCGCTGGCCA
AAGAGTTTTCTAGACATGACGTCCAGGTGCGCACCATATAATTCCTAGCCCTATCGCGCGTCGACGCTCACACAAGCTGC
AGACACTGTTTTTGGAGTCCTATGTCGATGACCAGCGCATCCTAACAGAGAATGCCCGAAGTGTGAAAATATCTTCTCCC
GATGTAGGTCATTATTCGATCTGCCACTATGGTTGTCCAGCCTTGCTTATGAACAGTTTGCTGGAATGGAGCCGGATGAG
GCAGCAGCACTCTATCTCAAGCGTATCGGTGCCAAGATTCCTGTCTTCGAGACAATGGACGAAAAAGAACTCAATTTTGT
CAAGATGATCAACGCTGGCCAGAAGTTCTTTTACAATAACGTTTCCTTCAACTATCTCTCTCATCGCATCGTCTTCTACC
TCACCAACCTGCACATCAAGTCGCGTACCACCTTCTTTGCGCGTTCCGGTGTCGCCGCCGATATCCCGGACGAAGACGAG
GCGTATCGTGCTGATCCGCCTTTGGGTTCGGATGGCAAAAACTACGCAGTGCTCATGTCCGAGGCGTTGCTGGCCCGCCG
TGAGCAGGAGCACAGGGCCGCGGTAGCGGCGCATCCGAACGGCGACGTACCGCCCCTACGACCACTTACCGTCTGGACAT
CGACGCGCCTGCGCACGATTCAGACGGCCGAATACCTTAAGGAACGTGGCTACAAGGTGCGGCAGCGTCCGCAGATGAGC
CAGATCAACCCGGGCGTGTGCGAGAGGCTTCCTGAGCGGACGCTGAGAGCGCTCTACCCAGAAGAGGTGGAGCTCCACGA
ACTCGACCCGTATCACCACCGCTTCCCACGGGCCGAGGTATGTTATCGTTCTTCTCACTCAACCCTACGCGGTATGTGCG
CATTGGCTGACCGTGTTTAGTCGTACCATGATTTGGCTGTGCGCCTGGAGCCTATCATCCTGGAATTGGAGCGGGAGCAA
AACGACCTGCTGATCATTGCACACGAATCTGTGCTGCGCGTGCTGTATGCGTATTTGATGCACTGCAGCGCCATGGATAT
TCCCAAGCTCAAATTTCCGCGCAACCAGATCATCGAGATTATCCCGGCGGCCTACCAGAACGAGGCGCAAATCATTCGGA
TCCCCGGCGTTGAAATTCCACAGTCGCGAGCCAGCAACAGCCCGGACAACATATTTTTCCACTCGCCCATGATAGTGCAC
AACAGCGGCCTTCTCAGCGGTGGTGCTTCGGTGGTAGGGAGCGGGGCCGTGAGCCCGATGCCGCAACTGTCGAGCCCGGC
AGAGCTGCTGGAACCGCTGTCACTGCCGCCGCCAGGGAAGACACAGTCAGTACCGCAGTCCCAAATCCACTCGCAGATCC
AGTCTGCCGCGCAGTCAACTACACACTCCCCGGTGGAGTCTCCTATGTTGCAGTATGCACCGGAACGGGTGGTAAACACT
TCCAAGGACGCTGTGGCTGACAAAGTTGCGGACGAGGATTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62