GenePrediction:GLEAN_472 Details

Name: GLEAN_472
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:51266..52130 (+ strand)
Length: 865
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:51266..51983 (+ strand)
Length: 718
Type: CDS
Source: GLEAN
Position: GCSC_97:52078..52130 (+ strand)
Length: 53
>GLEAN_472 class=GenePrediction position=GCSC_97:51266..52130 (+ strand)
ATGTCGCGCCACTACGACGACGACGATGCCAGCCGTGGTCCACGCGGTGCATCACACGGCAGACGCTACAGCCGGGGTGC
AGCCGACGACGACGGCCGTGCGGCCCCGTACATGACGCCCGCGGGGAACTATGTTGCCTTTGAGCAGCGGGCTTCCAACC
TGGACATGGATGGTCGCGACGTGGCGCTGCAGGTGCCGTCTTCGCCTCACCGGCCGCGATCCGTGCCGCCGATGATTCCG
CGCCGCGGCGACTCGCGCTCGCCGTCGCCCGATTACGAACATGAGTACGAGTACGAGCACGAGCGCCGTGGAAGCCGCAG
CCGCAGCCGCAGCCGCTCGCGAGGCCCGCTCAAGAAGACCAAGAATGCACTGGACAGCGCTTTTAGCACATCGGCTTCGG
GCCTCGGTGTCGGCGTCATCGGCGCCATCGTTGGTGGCCTGGCCGCCCGCGAGGCCTCTGAGGCGGCTGCGCGCTCGAAT
CGTCGCCAGGGCCACGGCCACGATCGCAGCGATCACGACCGCGCCGCACTCATCTCCACCATCGTCGGCGCTGCTGTCGG
TGGCCTCGGCGCCAACGCCATCGAGAAGCGGGTCGAGCGCCGCCATCATCGGTGGGCAGACGACCGCGACGGCGACCGTG
ATGATCGCGATGATCGTGATGATCGTGATCGTCGTGATGACGACCGCGACGACAACCACCGCGGCCGCCACCATCACGGT
GAGCGGGGCGTCGTCATCAGTCGCAGCCCGAGCCCCGGCTCCAGCCACAGTCGCAGCCACAGCCGCCACAGCCACCACAG
CCACAGCCATAGTGACGACCGGCACCAACGGCGTGCCGGCCACAACGACGACTACCATGACGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62