GenePrediction:GLEAN_4731 Details

Name: GLEAN_4731
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:730004..726760 (- strand)
Length: 3245
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:730004..729803 (- strand)
Length: 202
Type: CDS
Source: GLEAN
Position: GCSC_167:729734..727706 (- strand)
Length: 2029
Type: CDS
Source: GLEAN
Position: GCSC_167:727648..726760 (- strand)
Length: 889
>GLEAN_4731 class=GenePrediction position=GCSC_167:730004..726760 (- strand)
ATGCCGACCCTTGCACGCAAGGTCATCATCTATGCTGCTGTGGACGGCTTGATCCTACAGCCGCTCTTATCCAAAAAGGA
GCAGAGAGCTAGCCCCCCCGTCAAGGTGCGATACAGCGACAATGCCATATTGCCCGCATCTCGGGACCTTTGTGTCGACA
CATCCAAACAAGCCACAAGCTTCGAAGCCTTTGGAATCATTGGTGGGTTAGGGGTGTAGCAGCTGCAAGGTTGGGGCACC
TGCCAGATGTGATGGCTGATGTTTTCACAGGTCTCATCAGTCTGTCCAAGTTCAGCTATCTCATATCCATTACCAAGCGC
GAGCACGTGGCAACTGTCAGAGGTTCTCCTATCTATGTAGCCACAGAGGTAGCTTTGACACCTTGTGCATCCTACAGTGA
TGCCAACGAAGCCGTGCGGAAGACAGCCCTACATCTCCAAAGTAAACCCGCAAGTGACCCGGCCGACGATGAAGACAGCA
ATAGCAACAGCGGACAAGCCAGTGATAGGGGTGACGCCGATCCGTCTCTATGGATGACAGATGATATCGAAGGCGAAGGG
TCTTTCAGCGACAAAGAGAGTGCCAAGGAGAGGAAAGCGACCACCCAAGGCAGCAACGATATAAACAACAGCATCGCTGA
GAATGTTATCTCTCGAAGAGGCAGTTATGGACGGTTCGCACAACGGTGGTTTAGCCGCGCTGGCTGGATGCAGGAACAAA
AGCGATTGATGGGGCTGACAGGAGACAACAAAGCGATCGACATCGAAGAGGAGGCCGTTGGAGACGAAAGCGCGAAGACA
GACTCGGCACCATCTAGAGACCGGCCAGATGGGAATTCCAAGCCAGATCCAGCATCATCTGAGACACCTACATCCGACAC
GTGTACCGATACTTCCAATGATACAGTGCCTGGGACAGGGCCATTGGCACCCTCGATAGAAGCAGCAGATGCTGTCCTAG
CAAAAGACAGCGCGGTGGTCAGCTTGCTTCCCAAGCTACTGCGTACGACACAGATGTTTTTCGGAGTATCAAGGGCCTTC
TACTTTTCATACGATTACGACATCACCCGCAGCTTGGCAAAGCAGCCCAGGGCGCGTTGGAGCGATATACCTCTGCACAA
GGTAGTCGACCCTCTATATTTCTGGAACCGCCATATCATCCAGCCGTTCATTGATGCCGGCATGGATGCCCTTACCCTGC
CTCTAATGCAAGGGTTTGTGGGTCAGCGCTCTTTTGTGGTAGACAGTAACCCACCTCAGACAGACGACGATGCCAAGGAC
TCGGTGGAGCTGAATGACTTGTCGTACCGGTCAGGGTCATCGCCGTTGATGAGCGCGCGGACGTCGAGCGAAGAAGAGCA
GCGGCCTTCTGAAAAACAGTTTGACATCACACTGATATCACGGCGGTCGGTGAAACGGGCCGGCTTGCGGTACCTTCGTC
GAGGCGTGGATGAAGACGGCAACGTTGCCAACGCGGTTGAGACAGAGCAGATCCTATCGCCATCGGCTGGCTACCAAGTG
CAGGCTGTAGTGCCATCTACACCAGATCATAAAGCATACTCATTCGTCCAGATACGGGGCAGCATTCCGTTGTTCTTCAC
GCAGTCTCCGTTCTCACTCAAGCCAGTGCCTGTGCTGCAGCATTCGCCCGATACCAACTTTGTGGCGTTGCAGAAGCACT
TTGACGGCTTGCAACAACAGTACGGCAGTGTGCAGGTGCTGAATCTGGTGGAAAAGCACGGTGTTGAGGCTGCACTCGGA
ACCAAATACGAGGAGAACGTGTCGCGACTCAACGTGGAAAATGACAAAGGCAAGACCAAGCATGGCATAATGTTTGAGTG
GTTTGATTTCCACCAGGCATGCAAGGGCATGAAGTTTGAAAATGTGTCACTCCTGCTGGAAATACTGAACCGAAAGCTGG
AAGAGCTTGGGAGCACTGTAGAAGAGATCGGCCCAGACCCGAGTGGGAATGCTGGAAGTACGGGGACTATTGTGCAGCAG
CAGAAAGGCGTGATTCGCACCAATTGCATGGACTGCCTGGACCGGACCAATGTCTGCCAGAGCTCGTTTGCCAAATTCAT
GCTAGATTCGCAGTTAAAGGAGCAAGGCTATGACATGTTGCTGCAACACGACCAGGAAAACTCGTGGTTCAATACGGTAT
GGGCCGACAATGGCGATGCGATTTCCAATCAGTATGCCTCGACAGCGGCCATGAAAGGCGACTACACGCGGACGCGCAAG
CGAGACTACCGTGGCGCATTGACAGATGCTGGTCTCTCCCTGACACGGTTCTTCAACGGGTAAGCTTGCTTCCACCTTGG
CTCTGCTTTGATGGGAAGACAAATCTAACGAGGCAGAATTGTCAATGACTTCTTCCTGCAGACGACGATTGATTTTCTGC
TTGGCAACGTGACGGAACAGATCTTTGACGAGTTCGAAGCGAACATGATGACTAAGGACCCGGCTATGTCGATGCAAAAG
ATGCGCGAACAGGCGATCGATCTCTGCCAGCGACGCGTGGTCGCAGACGAATCGGAGGAATTTGTCGGAGGCTGGACGCT
TCTTGCACCGCACAACGCAGACGTGAGCTTGACGGCGCCGCCGTTTGAGGAGGTGGTGTTGCTTCTGACGGACGCAGCAC
TCTATCTGTGCCGGTTTGACTGGAACCTGGAGAAGCTGTCGACATTTGAGCGAGTGGACTTGGGACACGTGGAGCAGATC
AAGGTGGGCACGTATGTGCTATCGACAGTGTCACCGTTGCAGACGGACGAGGCACGCAACGTCGGGTTTGCGGTGTCGTA
TCGGCCAGGACACAACGACATCTTGCGCATTAACACGCGGACGCTCTCGAACATGTTCATGGGCGACGGGGATGGCGGGC
CGGCGTCCAGCAAGGCCAACACGCTGCCGTCTAGCTTGGCCGAACTTTTGGGCAGACGGCATCCGGAACTACCGCTTTCG
AAGCGCATGGCTTTCAAAGCTCTGTACACGGATACCTCGCTGGCAACGTCGACGGCAGTAGCAGCCAAGGAATACGGCGG
GAAGCAGACGGAGAAGCAGCAGATTGAGTCGATCACGGCGGAAATCGAGCGGCTGGTGCTGCTGTCCCGGACAGAGGCGA
CGGGAGGCCCAGAGCAGACGCCAGTCATCGTCAGGGCAGACATCGTCTCGCTGGCCGAGGCGCACAAGAGCACTGGGCTG
CTCGGACATTTGGGCCATTCGTTGAAGAAGCTGGTCTGGGCATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62