GenePrediction:GLEAN_473 Details

Name: GLEAN_473
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:55483..57552 (+ strand)
Length: 2070
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:55483..55504 (+ strand)
Length: 22
Type: CDS
Source: GLEAN
Position: GCSC_97:55561..56183 (+ strand)
Length: 623
Type: CDS
Source: GLEAN
Position: GCSC_97:56238..56531 (+ strand)
Length: 294
Type: CDS
Source: GLEAN
Position: GCSC_97:56590..57552 (+ strand)
Length: 963
>GLEAN_473 class=GenePrediction position=GCSC_97:55483..57552 (+ strand)
ATGGCTGAAAAATACGACATTGGTATGTAGTGTCTCGCAACTTACGTACGGTTTCCAACCGCTGCTGACACCCGGTAGTC
ATCGTTGGAGCCGGGCCAGTAGGGCTGATGCTCTCGACCATCCTGGCGCGATGGGGTTACAAGATCAAGCACATTGACAA
CCGGCCGGAGCCCACTGCCACCGGCCGTGCTGACGGCATCCAGCCACGCTCTCTCGACCTGCTGCGGAATATGGGCTTGA
AGTCGGCCATCATGGCCCACCATCCCGCCCGAGTGTATGAGGTTGCCTTCTGGGACGCTGCCCACACTGGCGACGGTATC
GTCCGCACGGGAACGTGGGCTAGCTGCCCCGACTTCATCGACGCCCGCTACCCATTCACGGCTCTTCTGCATCAGGGCCA
CATCGAGCGGGTGTTCCTTTCCGATCTCGAGAAGAACGGCGTCACAGTCGAGCGTCCCTGGACGATCAAGGGCTTCAAGT
CGGACGAGGCCGCGAACCCAGAGTACCCGGTCGAGGTCCACCTGGAGCACATTGATGGAACGGCAAAAGAGACTGTCCAG
GCCAAGTACCTGTTCAGCGGGGAAGGTGCGCGGTCAAGTGTTCGGGAGCAGCTCGGCATCGGTATCAAGCACAAGGACCC
CATCGCATACGTGTGGGGTGTCATGGACGGCGTCATCAAGACGGACTTTCCGGACATCAAGGTACGACGACGCGTTCCGC
TTGCTTGTGCGGTGTAAGCTGACTGACCCGTCCAGATGAAATGCACAATCCACTCCCGAGAGGGCTCGATCATGGTGATT
CCGCGGGAAGACAACATGGTCCGGCTGTACATCCAGATCGCCTCGTCCACAGACCCAGACTGGCACCCGCGCAAGACAGC
AACAGCAGAAGAGGTGCAGGCAACGGCAAAGAAGATCCTGGCGCCGTATACGATCGAGTGGGAGCACCTTGAGTGGTATT
CCGTGTACCCGATCGGCCAGGGCATTTCAGACAAGTATACCATCGACCACCGTGTCTTCCTGGGTGGAGATGCGTGCCAC
ACACACAGCGTGAGTGCCAGCCCTTTCCCTACAGGACGTGAGTAACAGTCTGCTAACAACGACACAGCCGAAAGCTGGTC
AGGGCATGAACACGGCCTTCCTGGACGCGCAGAACCTTGCCTGGAAGATCCACCTGGTCGAGAAGGGGTTCGCGAAGCGC
AGCCTGCTGCAGACATACGAGTTTGAGCGGAAGGACGTGGCTGAGAAGCTGCTTGCCTTTGACAACAAGTATGCCAAGCT
GTTTTCGGCGAAGCCACCAACGGCCGACCAAGTGCAGGCGGCGGGCGACTCCGGTGCTACGGGCAACGCACAAGCCACGA
GCCCAGACGACTTTGAGAACAACCCGTTTGTGCAGACGTTCAAGGAGAGCTGTGAGTTCACGAGCGGCTACGGAGTGGCG
TACCAGCCGAGCGTCATCACCTGGTCGCCCGAGCACCCGGCACAGACGGCCACGGCCAACCCGGCAGGAAGCAAGCTGCG
GCCAGGGCGGCTGTTTGTCAACGCCAATGTGACGCGAGTGGTGGATGCCAACGTGGTGCACCTGGAGCAGGAGGTACCGT
TGAACGGGTCTTTCCGGATCTTTGTGTTTGCTGGCGAGCCAGACAAGACGGCACAGGCACTCAAGGACCTGGAGAGCGGG
CTGCAGCGGAGGGGATCGGTCTTTTCCGCCTACAGACGTGCGGACGAGGCCGCGGTGACCCATCTCGAGAAGCACAACCC
GCACAGCCACTTCTTCACCTTCTGCATCATCTTTGCGCGCCGGCGCGGCGGCATCGAGATCAGCCGCGACGTGCCCGGCC
TGCTGGCCCGCTACCGTGACCACGTATATGCGGACGACCGCGGCGTCGACGCACCAGCACACGCAAAGATGGGCTTCGAC
CCGCGCAAGGGTGGCGTCGTGGTCGTGCGGCCAGACGGCTACACGGCCTTTGTGGCCGGCCTCGAAGAGGGCAGCAGCAC
CATCGACGCGCTGGACCAGTACTTTGCGTCCTTCTGCGCCGCCAAGATGGGACCTTCCGCGCAGTTGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62