GenePrediction:GLEAN_4741 Details

Name: GLEAN_4741
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:669508..667215 (- strand)
Length: 2294
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:669508..667428 (- strand)
Length: 2081
Type: CDS
Source: GLEAN
Position: GCSC_167:667362..667215 (- strand)
Length: 148
>GLEAN_4741 class=GenePrediction position=GCSC_167:669508..667215 (- strand)
ATGGCCGACGATATGGCTACGCCGAGCGTGTCCCACCCCCGCAGCGGCTCGGAGGACTACGGCGCATACGATGATGCCAA
AACGTATTATACCTCTGACGAGCGCCACATGAACACTCGGGCCGGTGCGCGCACCCGCACATATTCCCAGAACAGTCTGC
AGAAGCAGTTTGCCCGTCTCGGCCTCAAGGAGCCATTCCGACGAGGCAGCCACGATGAAGCCACGCCGAAGCTGGGCCGG
CGCTTCCTCATCGATGTCGACACCACGTTGGAGAACCTGCAGTCCCAGGAGGACACGGACGGCAACATGCAGATCACCAT
TGAGGACAGTGGCCCCAAGGTGTTCACGCTCCGCACCGCTGGGTCCAACGGACACAACCGTTTCGACATCCGCGGCACAT
ACATGCTGTCCAATCTGATGCAGGAGCTGACTCTGGCCAAGGAGTACGGCCGTCGTCAGATCATCCTAGACGAAGCCCGT
CTCAACGAGAACCCGGTGAACCGGCTCTCCCGCATGATCCGGGACCATTTCTGGGACAGCCTCACGCGTCGAATCGACGC
CTCCAGCATCGAGGTTGCTGCCCGCGATCCCAAGGACTGGACCGACGACCCGCGTCCACGCATCTACGTGCCGCCCGGAG
CCCCAGAGCAGTACGCTTACTACACCAAGCTGGCTGAGGAGAAGCCCGAGATCCGGCTGGACGTGCAGCTGCTGCCCGAG
ACCATCACCCCGGAGCTGGTGCGCGACATGAACGAGAAGCCCGGCCTGCTGGCCGTGGCCATGGAGGAGGTGGAAGACCC
GGACACCGGCAAGACTACGCTGCGTGGACTGCCGTTTGTGGTGCCGGGCGGCCGCTTCAACGAGCTGTACGGGTGGGACA
GCTACATGGAGTCGCTAGGGCTGCTGATTAACAACAAGACGCACCTGGCCAAGAGCATGGTGCAGAACTTCTGCTTTTGC
ATCCGCCACTACGGCAAGATCCTCAACGCGACGCGGTCGTATTACCTCTGCCGCTCCCAGCCGCCGTTTTTGACGGACAT
GGCCCTGCGCGTTTTCGACCGCATCCGGGACGAGCCCGATGCCAAGGAGTTCCTCCGCACGGCCATCCTGGCTGCCATCA
AGGAGTACTTCAGCGTGTGGACGTCGGAGCCGCGCCTGGATCCCGTCACAGGCCTGTCGCGCTACCGGCCTGAAGGACTG
GGTGTTCCGCCTGAGACGGAGGCGACACACTTTGTGCACCTGCTGGAGCCATACGCGGCCAAGTACGACATGGCGATTGC
CGAGTTTGTGCGGGCCTACAACTACGGCGAGGTGAAGGAGCCGGAGTTGGATGACTACTTTCTGCACGACCGTGCGGTGC
GCGAGTCGGGTCACGACACGTCGTACCGCCTGGAGCGGATATGTGCAGACATTGCCACGATCGACCTCAACTCGCTGTTG
TTCAAGTACGAGCTGGACATTGCGCGGACCATCCGCACAGTCTTCAACGACAAGCTGGAGATCCCGGCCGAGTATTGCGT
GGGCAGCATGCAGCCAGGACAGGTGGAGACATCGGCGATCTGGGACCGTCGGTCCAAGCGGCGGAAGCTGGCCATTGACA
AATACATGTGGAATGAGGAGGAGGGCATGTACTTTGACTACAACACCAAGACGCGCGAGCGTTGCACGTACGAAAGCTGC
ACGACGTTCTGGGCCATGTGGGCCGGCGTGGCTAGCCCGAAGCAGGCAGCGGCCATGGTGTCCAAGGCACTGCCCCGGTT
TGAGGCCACGGGCGGCCTGCTCTCGGGCACGAAGAAGTCGCGGGGCGAGATCTCGCTGACGCGACCCAACCGGCAGTGGG
ACTACCCCTACGGCTGGGCGCCGCAGCAGATGCTGGCGTGGACCGGTCTCTCGCGCTACGGGTACGAGGAGGAGGCCGGA
CGGCTGGCGTACAAGTGGCTGTTCATGATCACCAAGGCCTACTACGACTTCAACGGCGTGGTGGTCGAGAAGTATGACGT
GACGCGACCGGTTGATCCTCACCGAGTGGACGCCGAGTATGGCAACCAAGGGCTGGACTTCAAGGGCGTTGCCAAGGAAG
GGTATGTGTTTTCCTCCAGCTCCCGTCTCTCGCTTAGTGTCATCTCGTGTTCTAACCGTGTTGCAGATTCGGCTGGGTCA
ATGCCAGCTACGTGTATGGCCTCCAGATGATCCAGGCACACGCACGCAACGCGTTGGGCACGATGACGCCTTGGGAGGCA
TTCACGGCGGCGATTGAGCACGAGAAGGAAAAGGCTCTGGCGACGATGGAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62