GenePrediction:GLEAN_4742 Details

Name: GLEAN_4742
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:665782..664054 (- strand)
Length: 1729
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:665782..664533 (- strand)
Length: 1250
Type: CDS
Source: GLEAN
Position: GCSC_167:664411..664054 (- strand)
Length: 358
>GLEAN_4742 class=GenePrediction position=GCSC_167:665782..664054 (- strand)
ATGGCTTTCAACAACATGCTACCGCCGTCTATCGACGCGCTGGCCGAGGACAAGGTGTTTGCAGCCGAAGTCGAGCAGGT
CAAGAAGTGGTGGAGCGAACCTCGGTGGCGCCAGACCAAGCGGCCGTTCACAGCAGAGCAGATTGTGTCGAAGCGTGGCA
CGCTCAAGATCGAGTACCCCAGCAACGCGCTCTCCAAGAAGCTCTGGGACATCCTGGAGAAGCGGTTCCAGACCAAAGAC
GCCAGCTACACGTACGGCTGTCTGGAGCCGACAATGGTGACGCAGGTGGCACAGTACCTGGACACGGTGTACGTGTCCGG
CTGGCAGTCATCGTCGACGGCCTCATCGACGGACGAGCCGGGCCCGGATCTGGCAGACTACCCCTACACCACGGTGCCCA
ACAAGGTCGGCCACCTGTTCACGGCGCAGCTGTTCCACGACCGCAAGCAGCGTCACGAGCGGCTGAGCCACGCACGCAAG
CAGCGCGACAAGAATGCGGCCCACATCGACTACCTGCGGCCGATCGTGGCGGACGCCGACACGGGTCACGGCGGCCTGAC
GGCGGTGATGAAGCTGACCAAGCTCTTCGTCGAGAAAGGTGCGGCCGGCATCCACATCGAGGATCAGGCGCCGGGCACGA
AGAAGTGCGGCCACATGGCCGGCAAGGTGCTGGTGCCGACGAGCGAGCACATCAACCGGCTGGTGGCCATCCGCGCCCAG
GCCGACATCATGGGCGTCGACCTGGTGGCCATTGCGCGCACCGATGCCGAAGCCGCGACCCTGATCACCAGCACCATCGA
TCCGCGCGACCATGCCTTCATCGTCGGCTGCACCAACCCGGCCCTGCAGCCGCTGAGCCAGGTCATGGCCGATGCCGAGA
GCGCCGGCCACACCGGTGTCGCCCTGCAGGCCGTCGAGGACAAGTGGCTGACCGAGGCCGGACTCCTGCGCTTCGACGAT
GCCGTCGCGGCAGCCATCAAGGTCAGCGGCGCACCGGCCAGCCTCGAGGCCAAGTACCGCGCTGCTGCCAAGGGCAAGAG
CCACACCGAGGCCCGCGCTGCCGCCCGCTCCCTGCTCGGCACTGCTGCCGACAAGATCCACTTCGACTGGGACGCACCGC
GGACTCGTGAGGGCTTCTACCGTCTCAAGGGCGGCTGCGACTGCGGCGTTGCGCGTGCCATCTCTTATGCGCCCTACTGC
GACGCCATCTGGATGGAGAGCAAGCTGCCCGATTACAAGCAGGCCGAGGAGTTTGCCAACGGCGTGCATGCCGTCTGGCC
CGAGCAAAAGTGGGTTTTTGTTTCTTTCTTTTCTTTTCTCTTTTTTTTCTTTTTGTTTTTTTTATAACTAGACCACTTCC
TAACCATACAGACTCGCCTACAACCTGTCGCCGTCGTTCAACTGGAAGACGGCCATGCCGCGGAACGAGCAGGAGACGTA
CATCCAACGCCTGGCCAAGCTCGGCTACTGCTGGCAATTCATCACACTGGCCGGCCTGCACACTACGGCCCTCATCAGCA
ATCAATTTTCCCGCTCGTTCGCACAGGTCGGCATGCGTGCCTACGGCGAGCTCGTGCAGGAGCCCGAAATGGAGCAGGGC
GTCGATGTCGTCAAGCACCAGAAGTGGAGCGGCGCCAACTACGTCGACGACCTGCAGAAATTGGTCACCGGTGGCATCAG
CAGTACGTCTGCCATGGGCAAGGGTGTCACCGAGGACCAGTTTCACTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62